Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2551-2580 from 3142 sequences on 86 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>25508 128 241     3p11.1    chr3:90399923-90400050 BLAT!
TTCTCAGAAAGAATTTGTCTTGTTTTTAGGTGAAGATATTTCTTATTTCCCCAGAGGCCT
CAATGGGCTCTCAAATATTCCCTTTCATATTCTACTAAATGACTGTATCGAAGCTGCTCA
ATCAAAAG


invisible?    
Gene introns: 0  

>33154 102 241     2p11.2    chr2:84250597-84250698 BLAT!
AGCACTTTGGGAGGCTAAGGCAGGCAGATCACGAGGTCAGGAGATTGAGACCAGCCTGGC
TATCATGGTGAAACCCCATCTCTACTAAAAATACAAAAATTA


invisible?    
Gene introns: 0  

>7088 127 240     6p21.1    chr6:44074815-44074689 BLAT!
CAGACCTCTACCTCTATGCAGCACTTTCCAGTTTGCAGTGCCTTCACCTTTTAGTCCTAG
AAAGTTTCTTCCAGCCTAGAACTTCTGTGACTCCAGGCCTTGGTGACAACTCTGAGTAGT
AGGTAGG


invisible?    
Gene introns: 0  

>8605 150 240     7q21.12    chr7:88011944-88011795 BLAT!
TTCTCCTGTTCTGGACCCCACTCAAAACTGGCAGCCTTTCAGGTCACTCAATAAATAGGC
CAGTGTAACACACCCAAATGATGAATGTGTTGCCTCCAAAATCCAAATAGGCCCACTAGG
CATTGTGTCTCTTTCTCGGTTGTAGGAAGG


invisible?    
Gene introns: 0  

>31170 111 240     13q33.2    chr13:106216317-106216427 BLAT!
CTGTGGAACATGATTATAGAGAATAGAATACTAATTGTTAAAAATAAACGTCATGCCTGA
ACTGACTGAATTAATTTCTTTCAATATGTTGATATATAAAGATCTCTAACC


invisible?    
Gene introns: 0  

>23480 123 239     1p22.3    chr1:87307482-87307360 BLAT!
GCTGGCCAATATTTGTTAAATTAAATGAAATCCTCATTCACAGTTCTGGGTCTTTGTCCT
AATAATTCTCTCTACCTGGAATGTCCTTCTGAGGCCCTCCTCAAATTCTCTAACCCACAC
TAA


invisible?    
Gene introns: 0  

>26026 110 239     3q27.1    chr3:184451822-184451888 BLAT!
GCTACAGCCACAAGCTGTCTCCACCATCAGATGTGGCTTACCTGGTTCCTGAGTCAATTC
CATCCAGATGGTGAAGCCAAGGCCTGAAGACCTTTCCTGCAAGGTCGCAG


invisible?    
Gene introns: 0  

>27417 114 239     12q24.32    chr12:127328482-127328595 BLAT!
AACAAGTGGAAGGGCATTGGCAACAAACCAGGGTTTGAAAAGAACTGCAGCAACCTATCC
ACATTTTGATGCATTCATATTCCTCTTCTCTGCAGGGGAATATGAATGCATTTA


invisible?    
Gene introns: 0  

>6795 150 238     1p36.21    chr1:16154871-16155001 BLAT!
GAGCGGCCGCCCGGGCAGGTACAAGCTGCTGGAGCCAGTTCTGCTTCTCGGCAAGGAGCG
ATTTGCTGGTGTAGACATCCGTGTCCGTGTAAAGGGTGGTGGTCACGTGGCCCAGATTTA
TGCTATCCGTCAGTCCATCTCCAAAGCCCT


invisible?    
Gene introns: 0  

>6829 110 238     9q21.32    chr9:86161560-86161667 BLAT!
AAAGCTTCAAACATCAATATTAACCTTGAATGTAAATAAAATAAATGTTCCACTCCTGGC
CAACATGGTGGAACCCCGTCTCTACTAAAAATACAAAAATTAGCTGGGCA


invisible?    
Gene introns: 0  

>7030 140 238     5q23.1    chr5:116001044-116001183 BLAT!
GGGAGGCCAGCTGGGAATCACATTGTGAATGAGTCGAGATGGCAGGATGGGAATGGAGAG
AAGACAAGGACATGAAGACGTTTGGAAAGACATGCAGAGCCTAACAGATCATCCTTCTTG
TGATTTGCTTGGAGTTCAGC


invisible?    
Gene introns: 0  

>12992 128 238     12q21.2    chr12:78038583-78038456 BLAT!
AAATCCGTATACTCAGAAAGAAAGGACCCAGTTTATTAAAAGAAAAATTTTAGAGACAAA
TGGCTTTAAACAATGATTACCATAGACCTCTAATAAACAAACATGCCCCACGTCAAAAAT
TCCTTCTT


invisible?    
Gene introns: 0  

>13560 142 238     4p12    chr4:45682493-45682626 BLAT!
AGGTGCCCGCCACCATGCCTGGCTAATTTTTGTATTTTTTAGTAGAGACGAGGTTTCACC
GTGTTGGCCATGGCTGGTCTTGAACTGCTGACCTCAAGTGATTCGCCCGCCTTGGCCTCC
CAAAGTGCTGGGATTACAGGCA


invisible?    
Gene introns: 0  

>20759 122 238     3p26.1    chr3:7756636-7756515 BLAT!
AGCTACCAGATGGGTGACTGTTCATTGCCATTGGCATGAGAACAAGATCAATTTAGCATT
TTGCACCTGCAAACCTTCATAGGTGGGAACAAAGCTATGTTCCAGTTCAACACTGTTGCA
CC


invisible?    
Gene introns: GRM7 (6902801 - 7783218)  

>32332 132 238     8p23.2    chr8:5532856-5532987 BLAT!
AGGAAGGACAGAGAGGGAATAACAATGGCTATAAGAGCACACGCAGAAGAAGGAATGTCT
TTAAATAGCAGGATTTAGCTTCTGACAGCCTTGTAGGTGCAGAAACTCAGTCCCTTTCAG
TCTTTTTTGAAG


invisible?    
Gene introns: 0  

>3514 115 237     5q21.3    chr5:107937390-107937504 BLAT!
CAAGTAATGAGTGAATTAGACAAATCAGCATTTTGTAACCCCATTCGAAATAATGTTCCA
AATAAAAATGATTAATTGATGCTAAAATCATGTTGTGGGGAACAGAATATTTTCA


invisible?    
Gene introns: 0  

>12689 144 237     2p22.2    chr2:37065597-37065456 BLAT!
AAATGTTTTGGTCATCTGGATTGCACTCAGAACTGAATTATCTATTCAAAGTTCTGTAGG
TTAGAACTCCAGGGAAACTCAACTGGGCTGTCTGTTCAAGGCCCAACAAGGCTGAAATGA
AAGTGTCTTCCAGGGTGGGTACCT


invisible?    
Gene introns: 0  

>13861 102 237     4p14    chr4:37024267-37024165 BLAT!
TCTGATGGCCAGTCACTACGCTCATCTTCAAGGCTCTTGTCTCCTTTGCAAAACTTCCTG
AAACACCACTGCACTGTAAGTTCGTTAGCAGCTTCTGGGCAG


invisible?    
Gene introns: 0  

>16260 141 237     5q12.3    chr5:63704477-63704617 BLAT!
GGGAAGCCCATCAGAGTAATAGCAGATCTCTCTGCAGAAATCCTACAAGCCAGAAGAGAG
TGGGGGCCAATATTCAACGTTCTGAAAGAAAAGGATTTTCAACCCAGAATTTCATATCCA
GCCAAACTAAGTAAGCTTCAT


invisible?    
Gene introns: 0  

>8564 134 236     1q32.3    chr1:213594588-213594721 BLAT!
GGGATTACAGGTGCCTGCCACCATGCCAGGCTAATTTTTTGTATTTTTAGCAGAGATGAG
GTTTCACCATGTTGACCAGGCTGGTCTCTAACTCCTGACCTCAAGTGATCTACCCACCTC
AGCTTCCCAAAGTG


invisible?    
Gene introns: 0  

>14897 128 236     5p14.1    chr5:28310554-28310681 BLAT!
CAGATTGATTCTTAGAATTAGAAGTAAAGCAATTTTATTTACCAGTCAAAATGTTACTAT
CTTCTCTATTACCATCCCTTACCTCAGCAAATTTGATGATAAACTCATTGTTATATACGT
TATTTGTT


invisible?    
Gene introns: 0  

>17318 126 236     4q34.1    chr4:175343142-175343017 BLAT!
CCCAAAGTGCTGGGATTACAGGCATGAGCCACCGTGCCCTTCTGCTTTGTGAAATAATTT
AAGTGAATTCACATGCATGCAACTTCTCCCATGTGTGAAGCAAGTCAAACACAAGAAACA
TGATCT


invisible?    
Gene introns: 0  

>22066 144 236     4q28.3    chr4:132515908-132515765 BLAT!
AATAAGAAAGTTATACAAGGAAAGGAATTTTACGAACAACCTGAAGAATCTTGAAAGTGG
AATCTTCCTTAGGCAAGTCTAAAGATGAGAATGCATCCTGGCCAACACCTCTATTACAGC
ACAGCGAGATCGTGAGCACAGAAC


invisible?    
Gene introns: 0  

>5947 144 235     18q12.3    chr18:39735525-39735668 BLAT!
AAGGGCATCAGATTAGAAGTAAGGGGATTTGAGTTTAACTCCTGGCTCTATCTCCTGTGG
ATTTGGGACCCATCACTTTCTATGTTTAAACCTCAGCTTTCATATCTGCAAAATGAACGT
TTGACAAGACCATTGGTTCTGAAC


invisible?    
Gene introns: 0  

>6533 132 235     2q21.2    chr2:135045224-135045093 BLAT!
CTGGCAGCCCCTGGGCAGAAGGCTGAAGGATCCATCTATGAGGAAACTAAGCAGAAGAGA
AAAGACTGAAATAGACATTTAGGGTCCAACGTCATCTATGGTTCCCTAGGAGGTGGCCCA
GCAGCTGCCAGC


invisible?    
Gene introns: MGAT5 (135011829 - 135206468)  

>11537 135 235     7q32.1    chr7:128301957-128301823 BLAT!
AAAACATAACAAGAGTCACCTTTGCTCCAGTTCCCAGTAAGTTCCTCAGCTCCATCGGAG
ACCACGTCAGCCTGGGTCTTATTGTCCATATCATTATCAGCATTTTTGGCAAAGCCATTC
AACAAGTCTCTAGAA


invisible?    
Gene introns: 0  

>15634 130 235     13q14.3    chr13:54599147-54599276 BLAT!
GGAGAATTACAAACCACTGCTCAATGAAATCAGAGATGCCACAAATAAATGGAAAAATAT
TCCATACCCATGGTTAGGAAGAATCAGTATTTTTAAAATGACCATATTGCCCAAAGCAAT
TTGCAGACTC


invisible?    
Gene introns: 0  

>27728 114 235     12q21.31    chr12:85389883-85389996 BLAT!
AGGAGCCGACACACCAAAAGAAATGTAGTTTCCACAACCTGATGATTTCATCCCCCTTAC
CTTAACCAATTAATGACCCCAATTTTCCAGTCCCTAGCCCTTCACAATCCCCTT


invisible?    
Gene introns: 0  

>31683 146 235     5q31.3    chr5:144396499-144396644 BLAT!
CAATAGAGTTTTGTCATTCCCCCATCAAGAGATGGAGCCTATCTTGTGACTGCTTTGATC
AATAGAATACCGCCAAAATGATACTGTGTCAGTTTTGCCTATAGCCCTCAACTGATCCAT
CAGTTTTATTCTTTTTTCCCTTGGAA


invisible?    
Gene introns: 0  

>32986 134 235     1p36.31    chr1:5876159-5876282 BLAT!
ACAGAAGAAAAATTAGGCATAGAAAGGAAGTATCTTGCCCAATGCCATACGTTCAGGAGT
GACAGACTAGGACTGAAAATCAGGCAACATTCTATCCTCTGCCCCTGAAGAGACTCAGAT
GTACACTTCATTGC


invisible?    
Gene introns: 0  

Shown 2551-2580 from 3142 sequences on 86 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs