Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2611-2640 from 3142 sequences on 88 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>15912 120 230     Un_gl0002140    chrUn_gl000214:29509-29390 BLAT!
ACAACTTACACTTCCAGTGTCTGATAAATATTTGCCCACAAACTCCCACGTTTCATCCAT
CCATCAATCAATCAAATCTACCTATCTTTATTTATTTATTGTGAGACAGACCTGAAATTT


invisible?    
Gene introns: 0  

>18470 138 230     9q33.1    chr9:120448095-120447958 BLAT!
ATGAATTTCAGAAATAATGAAATGTGCATATTATCATATTGGGAAACTAAGAAAAGCAGC
TCAGTAATCTTGGAGGAGAATGGAGTAAAGATAGCACGAAATGATTCCTATCAGCTTCAG
AAAACGAGAGGACAGGAG


invisible?    
Gene introns: 0  

>22159 101 230     13q14.3    chr13:54060674-54060574 BLAT!
GCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAACGCCAAAAATTAGCCAGGCATG
GTGGCACGTGCTTGTAATCCCAGCTACTGGGGAGGCTGAGG


invisible?    
Gene introns: 0  

>27964 153 230     6p12.3    chr6:47290581-47290733 BLAT!
TAATCTTCCTAAGTAATGGACTTGATTATTTCTCACAGTGCTCAAGAACCCTCAATAGCT
CCCCATTGATTGAAAAACTATGTATGAAATTATCAATGTAGCATTCAAGGCTCTTCACAA
TATAGCTTCAAACTCATCATCCACCACTCTCAG


invisible?    
Gene introns: 0  

>7848 123 229     Xq26.3    chrX:136238579-136238457 BLAT!
GCTTCAGTATTGTGTGTCTTTTGCCTTCCCATATGAACTTCAAAAACAGTTTGTTGATAT
CTAAAAAGTAGTTTGCTGGGATTTTGCTTGGCATTGTGTTGAAGCTATAGATTAGGTTGG
GAA


invisible?    
Gene introns: 0  

>8001 104 229     Xq22.1    chrX:99375257-99375360 BLAT!
AAATTACTTTAAGTGTTACATTCATGACCTAAATGGTTCAACATCTATTTAAATTCAACA
GATTTTTGCTCCTTGACCTTTAGTAGATCTAATTCCAATTCTGA


invisible?    
Gene introns: 0  

>12701 129 229     8q22.3    chr8:102186653-102186781 BLAT!
AGTGGCAAGCCATCCACATCAATTTGTGAGGAAAAAATTCATCTTTTTCATGCCCTAGTT
AAAGAGGACTGATAATTAACAGCAGAAACAATAGTCAACACCACAGACAACTCAATTGGT
TCAGCTTAC


invisible?    
Gene introns: 0  

>14359 144 229     18q21.2    chr18:51448429-51448286 BLAT!
AGATTAGGCTTTACGTGGTTACCAATTCTCTTTATTACAAGTAATGCAAGTGAAGTTGGC
TTAGAGTTTCCATTTGCTGGCTCTGTTTGTTGGTCTTGCAAGTCCAAGGGAACATAACCC
ATAATCAAAACACTCTGACTGTGC


invisible?    
Gene introns: 0  

>15641 139 229     1q31.1    chr1:189958846-189958983 BLAT!
GACCAATTGGTGTGGTAAAAGGAGACTTCTCTGTCATAACTGCAGCTAGTGTTGCCACTG
GGTCAAGGCAGCCAAATATGGCACCAAAAATAAGCATCTTGCCAATCTTGACATTCACAG
GTAAAGCTGCAAGGTGTTG


invisible?    
Gene introns: 0  

>18829 126 229     1p35.1    chr1:32889573-32889448 BLAT!
ACTGTTTGTCCAGAAGATTTCAGCTAAACTGGCAAACAGTTACAGGACGCGGTTAACATG
TCTGCTAACCTTGCTTAACAAAGCTGGCAAAAACATCTCCAGGAAGCAGGCAGAACACCT
GCTCCC


invisible?    
Gene introns: 0  

>9691 108 228     18q12.3    chr18:39735278-39735171 BLAT!
ACATAACTACTCCACCTTGCTATCTGATGGGAATCCATCCTGCCCCCTTAGAGCTGTCAG
CTGCTTATCCCTGGAGAGGGAGTGGAGAGGGATTCCAGACTGAACAAT


invisible?    
Gene introns: 0  

>13539 149 228     3p24.3    chr3:19824989-19825137 BLAT!
AAATCCTATGTGTTCATAAGTCACCCTAAAGAAAAGTATTCAAATACTGGAAGTTGTGTG
TTTACAAGTGAATATAAAAAGAAATAAAGATCACAAAGTTGACTTCATTTCGGTGTCTAA
TTTACTATGTTTTCCTCCCCTTGGGGTTT


invisible?    
Gene introns: 0  

>13911 124 228     3q25.1    chr3:151931135-151931012 BLAT!
TCTTCCTTAATTGTGATCCTATAGAGTTTGAGTTCTTACATTATAAGTAGTAAATAACAG
AAGTTGCAACATACTTCAGGCACTTTGAAAGTAGCTCATGTGAAAATCACCTTGAGATAA
TGCT


invisible?    
Gene introns: 0  

>17054 123 228     19p12    chr19:22389790-22389912 BLAT!
TGAATGGACAAAACCTGGAAGCATTCCTTCTTGAAAACTGGCACAAGACAAGGATGCCTT
CTCTCAACACTCCTATATTCAACATAAAATTGGCAGTCTTAGCCAGAGCAATCAGGCAAA
AGA


invisible?    
Gene introns: 0  

>20378 121 228     13q14.3    chr13:53638766-53638646 BLAT!
ACAGGCTTCACATAGAAGCGTTTGGGATAGCCACTGATCATTGATGAAATTTCAACACAG
AGACATGGGTAAAGGGATGGCAATTAAGCAAGGGGAAAGTAAGAAGTCTGAAAAGGATTG
G


invisible?    
Gene introns: 0  

>25093 107 228     12q11    chr12:37952460-37952354 BLAT!
CCAGCACTTTGGGAGGCCAAGGCAGGCAGATCATGAGGTGAGGAGATCAAGACCATCGTG
GCTAACAGAGTGAAACCCTGTCTCTACTAAAAATACAAAAAAATTAG


invisible?    
Gene introns: 0  

>31069 115 228     7q31.33    chr7:124377937-124377822 BLAT!
TATCCAAGAACTGTGGGACAATTACAAAAAATGTAACATACAAGTAACGGGAATACTAGA
ATACTAGAAGGAAAAGAAAAACAGAAAAAAATATTTGAAACAATAATGACTGAGA


invisible?    
Gene introns: 0  

>32508 130 228     3q26.31    chr3:175232491-175232362 BLAT!
GCCCATATTTCAGATTTTATCAGGAGTTCTTTCTCAAAGACAACACACCGCTGCTTGTAA
CTGTTTCCTGCACTTTTCTCCATATCTCCCCTACATGCACTTTTGGTGCATTCCAACCGG
AAGAGAGGAT


invisible?    
Gene introns: NAALADL2 (174577110 - 175523428)  

>32531 101 228     4p15.33    chr4:12056594-12056694 BLAT!
TGTTATTATTATTAATTACCTAATGTTCTCTTTTCTGATATAAAAATCTGGTTTTAGAGA
TCAATTTGTCAATTATGTCTCAATGTGAGCTTAATTAATCC


invisible?    
Gene introns: 0  

>13070 102 227     7p22.2    chr7:2912607-2912506 BLAT!
AGCTCGAGACCAGCCTGACCAACATGGTGAAACCCCAACTCTAATAAAAATACAAAATTA
CCCGGGCGTGGTGGCACATGCCTGTAATCCCAGCTACTTGGG


invisible?    
Gene introns: 0  

>18919 142 227     12p13.33    chr12:2487377-2487518 BLAT!
TTGTGAGCAGATTCTAGAGGTAGAAACAGCCCCAGAAACACAAGCTAGAAAAAGAGGAAC
AGCTTCCAGGAGAGTTCCAGGCATCCTAAGGGAAGCACGGGCCTCTGCATGTGGATGGGT
TCGAATGCCAGATTCCAGCACC


invisible?    
Gene introns: CACNA1C (2162415 - 2807115)  

>20618 101 227     10p12.31    chr10:19915821-19915721 BLAT!
TTCCAACTGAACATTAAAATCCAACTGCCTATTTCAAAATCAAACAAAAATCTAAATTAT
TAACTAGATTTAATTAGCCAATGTAATTAATTGGCTAATGG


invisible?    
Gene introns: 0  

>25291 124 227     2q14.3    chr2:123916068-123915945 BLAT!
CTGCAAGGAAATTATAAAATGAAGATAATATCAATAATGCAAGCTAAACTAACAATAAAA
ATTGTCAGAGCTGACACTTCTAATTCTAGTATAAATGCTTTGCTTGAAACATAGTGGTAA
ATAA


invisible?    
Gene introns: 0  

>29618 149 227     2p14    chr2:66470033-66470181 BLAT!
TTAGCAACATTACATAAATTAGAAGTGGACATAAAGCAAAGGAGAAAACACCAGCATAAA
AATATAAAATGGAACCAGCAATGGAGCTAATATAAGCTCACAGACTTCCATACATGAAGC
ATAAATTTGACTCAGACTTTTTAGTTTCA


invisible?    
Gene introns: 0  

>7314 146 226     6p12.3    chr6:51606735-51606880 BLAT!
AAGTCCAGAAAAGTCCCACAATTAGGCATGTGCTTATTTTAACATATCAGAATGTTTTCC
CCATAGCATAAATACCTGTAATGGTGGAATAATTCTTAAAACCAATAGAAAACTTACTAT
AGAACACCATTTGAGTAGATCTAGGG


invisible?    
Gene introns: PKHD1 (51480144 - 51952423)  

>13751 131 226     2q33.1    chr2:197690006-197690136 BLAT!
TACACATGGCCAACAGGTATATGAAAAAATTATCAACATCACTAATAATCAGGAAAATGC
AAATCAAAACCACAATGAGATAACACCTCACATGTTAGAATGACTATAGTTAATAATACT
ATATTGCAAAC


invisible?    
Gene introns: 0  

>14367 111 226     2q31.3    chr2:181829242-181829132 BLAT!
AAAAGACATAGCAATTTGACTTTGTGCTCACATCTGATCACCACTTTTGGATGAAGTGGC
TTTATGTATAGAAGTGTTTATCACAGCAAGATTATAAAAGAAAAATGGAAA


invisible?    
Gene introns: 0  

>25435 100 226     10p15.3    chr10:2280541-2280442 BLAT!
ACTCATTCTCATTCTTGCCACCCTGTAAAGAGGTGCCTTCTGCCATGATTGTAAGTATCC
TGAAGCCTCCCCAGTCATGTGGAACGGTGAGTCAATTAAA


invisible?    
Gene introns: 0  

>26152 132 226     5p12    chr5:44431261-44431130 BLAT!
ACACACACACGCACACATACAGTCTTCTTTGATACCCTTTTTATGTAATCATGGACAAGT
CAATTAGCCTACACAGGACTCAGCCTTCTCATGTGGGAAGAAACATTATTTACTCTAGAG
AACTCTAACCAA


invisible?    
Gene introns: 0  

>28216 127 226     3p13    chr3:70036739-70036613 BLAT!
GATTCAGAACTTGTGTGGACCCTGCAGAAAAATCCACAGACTTATGAATGTTCCATTAAC
ATATTTGATAAAAGAAAAACAACTATTAGCCTTTCCCCTTATGAAACTCTATTTTAAAGC
TTCATCT


invisible?    
Gene introns: 0  

Shown 2611-2640 from 3142 sequences on 88 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs