Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2641-2670 from 3142 sequences on 89 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>8331 133 225     4q34.3    chr4:181031950-181031818 BLAT!
GGTAGCAGTAGGCAGAGGGAGTGCATGAGCTGACAAATGACAATGAGAAGCTTGGGGAGC
ATTGACAAATGTCTGGCTGAAACTAGAGACAATGAAGGTGTAATGGTTCCCAAGTGCATA
ACTGCATGATTTT


invisible?    
Gene introns: 0  

>11752 104 225     18p11.21    chr18:14884971-14885055 BLAT!
AGCGTGGTCGCGGCCGAGGTACACATGAAGTTTTAATGAGCTATTTCATATTAAGATACA
TATTGAGAATTCAAACCAGAGAGACCAGTTAATAGATATTTTCC


invisible?    
Gene introns: 0  

>21941 117 225     Xq21.1    chrX:82810453-82810337 BLAT!
AAATTTATGTTGTCAATATATTTAGAGTTAGGATGGATATAAAATCACTCATAAGATACA
GAAAATATTTTAATGAAATTCCTCTTTTTAAGAGAAATGAAAATTTTTATCAAAATA


invisible?    
Gene introns: 0  

>23700 112 225     2q22.1    chr2:138840558-138840447 BLAT!
GTGTGGTTTTATTTTTTTAAACTGAAATACAACCTGTATACAGTATACATATCATTAGTG
TATAGCTTGATGCATTTTCATAAACTGATTACACTCATGTAATTTTCACCCA


invisible?    
Gene introns: 0  

>23818 131 225     3p14.3    chr3:55365326-55365456 BLAT!
AAACTGCAATTTCATATGGTCTACCTAACAAATGCTTTACATGTTTTATCTTCTAATCCT
TACAACAACTGGTAAGGTAAGTCCTCTTACTCTTCCAAGTTCATTCATATATCAACTCCA
GGAGGACAGAA


invisible?    
Gene introns: 0  

>30764 132 225     2q36.3    chr2:230630040-230630171 BLAT!
AACAGCAAATGAAGTATATACTTTTTCCCTCTGGTGCAATAAGGTCTCTGCCAAGAGAGA
TTACTTTAAGAGTTTTCCTGCCCCAAATTAACCAAAGGTCCCGTGTATTGAAGGAGGAAT
AAGCTAAAGGCT


invisible?    
Gene introns: 0  

>14379 149 224     3p12.2    chr3:83228650-83228502 BLAT!
GAAGCAAAAGTTACAACACTATCAGATGTGGTGCTCAATGTATACAGAGGACATATTTTG
TCTTGTCTATCAATCAAGCTGTCTTGTCTATCAGTCAAGACCGAAATTGGCAAGGAAGAT
TAAAATATACACACACAATAAACTATATT


invisible?    
Gene introns: 0  

>16273 130 224     4p13    chr4:44096464-44096593 BLAT!
AATTACAACACCACCAGTGGAGTATGAAAATGTTTGAGCTTAACTTTCTCATTCACTCTT
ATATTTTGGTCAGTTTTTGCAATTTCAACCATTCTGTTTTGTCGTAGATTACCGTGGTCT
TAACTGGCAT


invisible?    
Gene introns: 0  

>17044 111 224     5p13.3    chr5:30315828-30315938 BLAT!
CCTAGGAAACTAATACAGAGTTTAGAGGTAAGCAAGAGTCAAATTATATAGGACCAGTAG
TCTTCCGTGTTTATTTGTTTGTTTTTGCTCAAAACCATGAATTCATTGAAT


invisible?    
Gene introns: 0  

>20450 101 224     6q14.1    chr6:81848165-81848265 BLAT!
TGAAGCCTCTTATTGTCCTAGGAAGCACCCAAAAGGCAGGATGTGTGACCCCACCCTCCC
TTATTACTGGTAGCAGGCAACACCTGCCAGAGCTTCTGGCC


invisible?    
Gene introns: 0  

>23059 126 224     5q21.2    chr5:102930018-102930143 BLAT!
CATTATCACCTGGGCTCATGTCCCATAAACCTTGAATATCCCCTAATATGACCACAGCAT
TCACTCCCACCCCATATTCCAAACTCTTTCACTGTGCTCTGTTTATCATCAAAATCTAAC
CTCTCT


invisible?    
Gene introns: 0  

>3181 127 223     2q14.3    chr2:123916486-123916612 BLAT!
GTCTCTTCACTTTGTTGATTGTCAACTTTGCAGTGAAGACTTTTTAACTTAATGTGATCA
TATTTGTGCGTTTTCACTCTGCTTGCTTGTGCTTTTGAAATAAGCTAAGCGCAGAAAGAC
AAATTTC


invisible?    
Gene introns: 0  

>6285 114 223     10q24.2    chr10:100414382-100414269 BLAT!
GCAAAAATACATGGTTAATATAAGTAGAGAGATAGAAACTACAATGGAATCAAAAGGAAA
TGATAGAAATAAAAAACATTGTCACAAAAATGAAGAATGCCTTTAGTAGGCTCA


invisible?    
Gene introns: HPSE2 (100216833 - 100995632)  

>15747 120 223     1p11.2    chr1:120679961-120680080 BLAT!
CAGTCCCTCTAAATGCTAAAAATAGAGTTACCATATGACCCAGCAATTCTTTTATCTTGG
GAATCTACCCAAAAGCAATGAAAACATATTTCCATACAAAAACTTGTGCACAAATGTTCA


invisible?    
Gene introns: 0  

>16948 136 223     9q31.2    chr9:109521125-109521260 BLAT!
CTTCATCAAAATAAAAAACTTTAGTGCATCAAAGGATACTATAAAGAGAGTGAAAAGGCA
AGCCATAGAATACAAGGAAATACTTACTAATCATAAGGAACTGACATTCACAATACATGA
AGAACTCTTAAACTCA


invisible?    
Gene introns: 0  

>20184 119 223     12q21.32    chr12:87891994-87892112 BLAT!
TGAACAGTGAGTGGCCTCACTCCTATTTCCACCTTTTGATTTCTGGATTTGTGAATCCTG
GCTATCAGTGAAACAACACAATGTATAGGCATTGACTCAGAGTTTAGATTGCCTTCTGG


invisible?    
Gene introns: 0  

>24709 129 223     6q23.3    chr6:136531797-136531925 BLAT!
GCTGGTGGAAGGAGGGGGCCGTGGGGTGTGATCCAGCCAGACTGCAAATCTAAGAGTCCA
GAACACAGACCAGCATGGCAGAGGATGGGGTAGCACAACAGACGAAATATCCAAGCAGAA
GAAATCCTA


invisible?    
Gene introns: 0  

>29153 100 223     4q28.3    chr4:133472629-133472530 BLAT!
AATAATTGTTGTAATTGACTATATCAAAGAATATATTGTGTGATATTAATCTTCGAAGTT
TTAGGGTAATAAGGCCTAATTTATTTGAAGTGCTTGAACT


invisible?    
Gene introns: 0  

>31655 123 223     15q21.1    chr15:47365994-47366116 BLAT!
CAATTTTTAAATGTGACCTTTTAGGAAATAATGAAGTCACATAAATAAATTTAATACTTC
CAGTTAAAAAACAGATATAGTATTCTTTTATTAGAAAATTATTTTTTATCCATTCTGCTA
GCT


invisible?    
Gene introns: 0  

>4590 113 222     11q14.3    chr11:90692275-90692387 BLAT!
AACACAAACAAATGAAAAATATCTGATGATCAGAGATATGAAGAATTAGTAGCACTAAAA
TGGCCATACTTTTCTAAGCAATTTATGGATTTAATGCTATTCCTATCAAACTA


invisible?    
Gene introns: 0  

>5238 132 222     6p12.1    chr6:53599649-53599518 BLAT!
GGAGGCAGTTGTAAAACTTTGCTGCAGAATCACACCTTCGATCCAGGCCTCACAGGATCC
TCACAGATAAAGGCTCAGTGTTGATAAATTCGCAATCTATATTTATGAAACACTCAAGCT
ACCAGGAGCAAG


invisible?    
Gene introns: 0  

>5465 117 222     5p12    chr5:44431665-44431780 BLAT!
CCATTCCCCAGTCTGACATTTACTGAACATAAGAAACTTCTTGGCCTACCTAATGGTGCA
TCACAGTAGATCATGATAAGGAAGCTTTTGGGAGAAATAGATTATCTTGAGTTAAAG


invisible?    
Gene introns: 0  

>6128 105 222     10p13    chr10:16198323-16198427 BLAT!
AAAGCACTTTTCTGAACTAGGAATAATCTCAGACTATAATATCCTGAGTATGGACAAAGG
TCGCCAAAGCTTAGGGATATGAGGCTGTCAGTGTGAGATTCAAAG


invisible?    
Gene introns: 0  

>12443 106 222     18q12.2    chr18:35926990-35927095 BLAT!
AGAGGAAACTTGGATATATTTTATTGGATAATATAGATGGTGCTATGTTACTTTTATTGG
AGCACAAATAAAGCGGGGGTAAAAAGGTCAATGACTCTGGGTTGGT


invisible?    
Gene introns: 0  

>16688 111 222     7p15.1    chr7:28331566-28331676 BLAT!
TTTTTGCGCATGTCAAGTATGAGATACCTATTAGCCATGAAGTAGAGAAAGTGGGTGAGA
GGAAATGAGAGGTCAGGGACAGAGAGAAAATCTGATTGACATTGAACTGCC


invisible?    
Gene introns: 0  

>16974 101 222     5q23.3    chr5:128525614-128525714 BLAT!
AAAAAAAAAAAGAAACACAACTTTTACCCTAGAATAATATATCCAGTGAAAATATCCTTC
AAACATGAAGGAAAAATAAAGACTTTCCTAGACAAAGAAAA


invisible?    
Gene introns: 0  

>18671 149 222     3p13    chr3:72350250-72350398 BLAT!
CAGGACCCTCTTCGAAGCTCCCCACACCTATGCCGCCCCTTCCCACAAACTACCCTGAAA
AGCCTTTGCTTAGTGTCCGCACTGTCACCCACACTGGACTCAAGATCCTTGGGTCGGGGA
CTCTCTCTAGTTCAAGGCTGGAGCTTGGG


invisible?    
Gene introns: 0  

>31098 137 222     12p13.33    chr12:1761624-1761488 BLAT!
CCGCCTGCCTTGGCCTCCCAAAGTGCTGGGGTTACAGGCGTGAGCCACCACACCCGGCTG
TAAGTCAGTTTTCAAATGCCTGCTGGGTGCCCCCAAGAGCCGTGGAAGATTTGCAGAAAC
ATCCTGGCAACCCTTAC


invisible?    
Gene introns: 0  

>4231 131 221     8q11.1    chr8:47471431-47471301 BLAT!
ATCACTTTGCGTAACTACTGTCGTATACTTTTTAGTATGCCCTGTTATGAAGCACATCAA
ATCTGGTTGTCCTGCTTTTAGAAAATCTGTCCATATATTGTTTGTCACACTTCCCATGGA
GAGTTGGAGTC


invisible?    
Gene introns: 0  

>5786 122 221     Xp11.21    chrX:57250392-57250271 BLAT!
GGGCTTTAAGGACAGACGTAATTTTTTCAACTTTGCCTGAGAATTGAGGCCTATAGGGTG
TGTGGAGAACCCATTTTATACCTAAGGATGTAGAGATGCCTTGGATAATTTGGCTGATGA
AG


invisible?    
Gene introns: 0  

Shown 2641-2670 from 3142 sequences on 89 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs