Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2671-2700 from 3142 sequences on 90 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>6446 112 221     Xq21.31    chrX:87685532-87685643 BLAT!
ACCTGCAGACATGTAAATGGTCCTTATCAAAGTAACCAGGGTCACTGCCGCCATCCTATA
ATTCTTCAGTCACCAGTGGAAGAAACAAAAGGTTCTATGAGAAGTCAAATGA


invisible?    
Gene introns: 0  

>8363 122 221     12q21.2    chr12:78017290-78017391 BLAT!
AGCGTGGTCGCGGCCGAGGTACAAATTTTGTAACAAAATCAGTAAGAGTTTAGATGCATA
TTATCTAAGAGGCAGCATAATTAGAGATAAAAAAATATTCACAGAAATCTATTTTACCGC
TG


invisible?    
Gene introns: 0  

>9204 116 221     6q14.1    chr6:77948438-77948514 BLAT!
ACCACAAATGGCACAGACCATTCCGGAATGAAGGTTTGGGCCACTCTACCGGGAAAAAAA
CAAAACAAAACAAAAAAACCACGATCTGATGAGTGGCTTGCTGAAGGCAATGGGAA


invisible?    
Gene introns: 0  

>10442 104 221     9q21.2    chr9:80952248-80952351 BLAT!
TCAGCACCACATTGCACTTATTCTAAAATTGACCACATAATTGGAAGTAAAGCACTCATC
AGCAAATGTAAAAGAACAGAAATGACAACAAACTGTCCCTCAGA


invisible?    
Gene introns: 0  

>11544 117 221     17q11.2    chr17:28666446-28666332 BLAT!
CACACACACACACACACACACACACACACACACACACAGTTTTGCCTACAATTTCAGCGG
TTTCATTGACACTCTAAAGCTCATCCATAGTAGTTCAAGAAGCCAAATTTTAAAATT


invisible?    
Gene introns: 0  

>21123 110 221     6q16.2    chr6:100258227-100258336 BLAT!
TCTTCCCTCCCCTCTGAGATTATTTCTGTTAATTGTATCACCAACCTCATCATCCAGCTA
GAAATCAAGCCATCCTCTTTAACTTGTCTGTATCTCTTACCTGTCACCTC


invisible?    
Gene introns: 0  

>21301 100 221     9q31.2    chr9:109485068-109484969 BLAT!
GACTGTATCAAACTTAAAAGTTAGCAAAGTCTTAGAAAGTCCTTTATAGCACAGGTAGAG
AGAGTTATTTTCACTTCCACAAGCTATATAATCTCCATTG


invisible?    
Gene introns: 0  

>25424 113 221     8q24.13    chr8:124302248-124302360 BLAT!
CAAAACCAGTATATCCAGGACAAACTCTACAAACTGAGATGTGGAAGGAAGGAAACAGAA
TTCATTTTCAAACCAAGGTCCAAGAAACTGGAGACATTGTCATTTCAAATGCA


invisible?    
Gene introns: 0  

>28188 101 221     7p11.2    chr7:57771475-57771375 BLAT!
TTTTATCTATTCTGCTAGTTCTCCCTCTCTCACTATACATATAGTTATGTATCTTCCATC
TATATCCAAACTTTTTGGAGTATGAAATTTGAAACACATAT


invisible?    
Gene introns: 0  

>12846 147 220     2q31.3    chr2:181640066-181639921 BLAT!
TTGTGCTCAGTCTGATTTTTAAAAGAATTATCTTGATTAAAAAATTAAAACAATACTTCC
TTTCTGTTAAAAAAATTTGTATAAAACTTGGAAATAAGAAAAAAAAGAATGTCTGCATGT
CCTTTCACCGTCTTACTGGAGCATTGT


invisible?    
Gene introns: 0  

>14449 119 220     18q22.1    chr18:62867538-62867420 BLAT!
TATTCTGAAGTTCCAATGAGATAGTGGATATGGATTCTTTCTATAAACAGATAAAAGTAT
TACAAATCTGTGTTGCTATTATTATTCTATTATTGAACTTTAAATACTAATAGTTCCAA


invisible?    
Gene introns: 0  

>15799 129 220     5p13.2    chr5:34325459-34325587 BLAT!
AAACCTATACATAGTCTTTTAACACATAGTTTTTTTACTTGTTTTGTTATTGTTATTGAA
GAAGACATATTCTTGGGCTTGATGATATATTACAATTCTATACACCAAGGAAATTACTAT
GTTTCTCAA


invisible?    
Gene introns: 0  

>16090 101 220     4q22.1    chr4:92152412-92152312 BLAT!
ATTCCATTGTGGAGCTAAGCCATCTTTTATTCAACTATATCCCTTTCAACGACCATTCAC
TTTGTTTCCCCTTATTTTATGTATGCCATTGTGATTAATGC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>21375 101 220     5p13.3    chr5:30223509-30223609 BLAT!
AAATTAAAGTAAAATAAAGCAATAAGTATTACACACACACACATTCTCCCTATTAAATAA
CTGACATAATGTTAAGCTTAAATAAAATAATTAAATGAGAC


invisible?    
Gene introns: 0  

>28484 105 220     4p15.33    chr4:12471464-12471360 BLAT!
GCAGGTGGATCACTTGAGGTGAGGAGTTCGAGATCAGCCTGGCCAATATGGTAAAACCCG
TCTCTACTAGAAATACAAAAAATTATCTGAGCATGGTGGTGTGTG


invisible?    
Gene introns: 0  

>3898 103 219     6p11.2    chr6:57841124-57841226 BLAT!
CTGGATCCACGCTTCCTTCAGGGTCTTCATCATTATAAATGTTCTCTGCCATTTGCCACA
CTTGCATGATATTGTCTTCTGATACAGAACAAATCACCCAAGG


invisible?    
Gene introns: 0  

>13972 144 219     12q14.1    chr12:60521212-60521355 BLAT!
TTAATCTGACATTTCATACTTTCAACATTTATGTTAATTGTGTGGGATAATACCTTATAG
ATAACTTGTATAGTTATTTCTGATTTATGTATAAAAGAGTGTCTAATTTAAAGACAAACA
AAACTTTCCAAATAAAGAAACCAT


invisible?    
Gene introns: 0  

>15823 137 219     Xq21.2    chrX:85340939-85341075 BLAT!
CTGATACAGATTAGGCATGTTGAAAGGGTTCATGAATTTTCTCTCTGCCAACCTGGCCTC
CATATTCTGTAAACCCTCTTTCAGTTGAGGGTTATTTGCCTCGTGTTTTAAGCCCTCCTC
ATAGGTTCGCTTGGCTT


invisible?    
Gene introns: 0  

>16837 102 219     6q22.1    chr6:118225303-118225404 BLAT!
AGACTATCTTCATTGATGATGATTGTTCACTGAAGTTCTGTGCTTTAACATGCCAATTAT
TGTATCCATTTCCTGGATGTAAATTGATTTACCCATTCTACT


invisible?    
Gene introns: 0  

>4214 106 218     21q21.3    chr21:27961460-27961355 BLAT!
CATGTGGGAGCAATTGACAGTAAATCGTAAACCAATCAATACAAAAGTTAACTCAGATAG
TGATAAGTGTTATATGGACAATAAGAATATATTGTGTTAGAAATGA


invisible?    
Gene introns: 0  

>14206 114 218     6p22.1    chr6:28390951-28391064 BLAT!
CTGTCATCTGCAAGGGCAGGGATACACAGACAAAGAGGGGAAAATACACAGGGCCTACAA
GTTAAAAAAAACTCACCAAACTAGAACAAAAATAAATAACTCTGGCCAATAACA


invisible?    
Gene introns: 0  

>16207 104 218     2q31.1    chr2:171386631-171386528 BLAT!
GAGAAGTTACTAAGATGCACACGGAGATGTTGTGGCATTACTACTGTTAACAGCTTTTAA
TGGCAAATACTCCAGTTTCTTCTTAATTTAAGGTGACCAGGGCG


invisible?    
Gene introns: MYO3B (171034654 - 171511674)  

>16328 123 218     4q34.1    chr4:172604171-172604293 BLAT!
CAGCCCATTTTTCTAGTTTTCTATCCTAGGAGGTTTAAATGAATGGCATGTGAACATTAG
GATTTTAAATCTAGGACTGACAAAAGAGATTTCTCTTTGAATACCAATTGTATGGTATCT
TAG


invisible?    
Gene introns: 0  

>28170 114 218     21q22.2    chr21:40539022-40539135 BLAT!
ACATACAAATTTCAGGATTTTTGTATTTCTGTGAAAAATGGCATTAGTATTTTGATAGGA
ATTGCACTGGATCTGTATATTGTCCTGGACAACATGGTCATTTTAACAATATTA


invisible?    
Gene introns: 0  

>33145 123 218     2q37.2    chr2:236158305-236158183 BLAT!
CCTGCACTAAGGGAAAGCCAAATGGTATCCTTAAGCTTTTAATAATGTTATCTCCTAACA
AAGAGATGTATTTGTTTATTTGCTTCTGGAAGGCAGCATATCACATCAACTGGTCAAGGT
GTT


invisible?    
Gene introns: 0  

>3203 119 217     3p26.2    chr3:3810336-3810419 BLAT!
CATTTTAAAAATGAAGAAACTGAGGTAAAAAAGTTAAGTTACTTCTCTAACTTTATTCAG
TTAAAACCAGTGTGTCCAGAACCTCCCCGCGTACCTCGGCCGACCTCGGCCGCGACCAC


invisible?    
Gene introns: 0  

>3934 106 217     6q24.3    chr6:145772212-145772299 BLAT!
GAGCGGCCGCCCGGGCAGGTACTTGTTGTCAATGATACGGTTTAAGCTTTTAAGTGAAAT
TTAGAATTTTAGAAAACATTTATGTGCCACCATTAACTTCACAGTT


invisible?    
Gene introns: 0  

>7556 119 217     4q22.1    chr4:92305066-92305184 BLAT!
ATGGATCTCAGCAATAGACTTAATTTTAAAATCCCAACACTGCTGTTGGAAGATTGTGGT
GAAGGGCTGTGAGCAAACCTGCAGTTTTTGTTAAAGAATCAACTTTGGCTCCCAGTGGG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>10100 113 217     7p11.2    chr7:57865684-57865796 BLAT!
TAAAGATAATACAAAGTGAATTTTAGTAACAATCTTGAGTCATCACAGAAGCTAATGAAG
TTGGGGATTCCACGAAGCCATCCAAGCATATAGAGCCCATTTCCCTGGGTCCC


invisible?    
Gene introns: 0  

>13123 120 217     4q13.3    chr4:72797712-72797831 BLAT!
TATACTATCATTGGTCTATTTACAATGAAAATGGTGCATGGGGAAATTTTTATTTTAGGG
GAATCTCCTGACCTCAAGCTAAATGAGGGTCACTTGGGATTGAGGTCACCATGAAAAGTA


invisible?    
Gene introns: 0  

Shown 2671-2700 from 3142 sequences on 90 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs