Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2701-2730 from 3142 sequences on 91 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>19631 117 217     8q11.21    chr8:51706020-51705904 BLAT!
CATGGGTCAATGTAATTATCCTTTGGAAGTTCTTCGGAATATTTACAATAAGATAAAAAC
AATTGGAATGCCAGTGTCAAATCATGGGATGAGAACACAAGGGCAAATTTACATCAG


invisible?    
Gene introns: 0  

>24361 114 217     Xp22.32    chrX:4689155-4689042 BLAT!
GTATTACCATTTACATAGGATAAATGTTGTTTACCCTTAAAGGTATTGTGTGTGTGTCTT
TTCTTTTCCCCTTGGACGTTTCCCACACAGAACACCCCCAAATTCTCCAAATCT


invisible?    
Gene introns: 0  

>27375 101 217     14q32.12    chr14:93238248-93238348 BLAT!
GTCTTCCATGAAACCTGTCCCTGGTGCCAAAAAGTTTGGGGACTGCTGGCTTACACAGGA
TAAAAACACAGGCCAGATTCTTGCCCATGGGCTAAGCAGTG


invisible?    
Gene introns: 0  

>29732 103 217     2q31.1    chr2:174908571-174908469 BLAT!
GCTGAGCAGTGGGAGCTGCAGACTAGTCTTCCGTGGCAAGCAGAGCGCTCCAGTCTTCAG
TAGGGAGCTGCTGAATAGGCACAGAGGGCATCTGCCACCTTTA


invisible?    
Gene introns: 0  

>31430 113 217     11p15.1    chr11:20233961-20233849 BLAT!
GCTGTGTCCTCACTTGGCCTTTGCTCTTTGGGCTTGCATCCCTGGTGTCTCTCCCTTTTC
TTAGAAGAACACCAGTCACATTGAATTAGGGCCCCAGCCCTATGACTTCATTT


invisible?    
Gene introns: 0  

>7397 122 216     8q24.12    chr8:122227145-122227266 BLAT!
GAATACATAGGTCCTAGAACTAAGCAGTGAATGTAACAGTAGCCTGTTTAATTATCATTC
CAAGTGACCCACTTAGGGAAATTGTGCTTCTCATTCTGAAAACTCTGGGCTTTGTGGGCT
TA


invisible?    
Gene introns: 0  

>15936 135 216     4q32.1    chr4:156577816-156577950 BLAT!
ATTCAGTAAAAGTATTTGAATGAATGAATGAATGAATCTGACAAGAGTGTATTTTGCCTC
TTTTTGAATGTCAGTCTACAGATAAAAGGGGGCTCTAATTATCACATGGAAAATCAGACC
GTGCATACTTTAATT


invisible?    
Gene introns: 0  

>16617 102 216     10p15.1    chr10:4244710-4244609 BLAT!
TTTCTTTGATGCCTTATCACCTTGGCCTGCCTTCAGCAAGGATTTGTTGTTATTTTGGTT
GTCATTTGTTTGTTTGTTTGTTTTATTGAAACAAGGCAGATT


invisible?    
Gene introns: 0  

>19510 124 216     13q21.2    chr13:61693530-61693407 BLAT!
TGCTCAAAGGCAGGAAATATGTGTGTGCTCAAAGAGAAAATAAAGGGGGGTTTCTAGGGA
GCTGGACTAAACTACTCAAAATGTCTTGAGGATGTTATCTCATATGAGGTGACAGCTTTT
TATA


invisible?    
Gene introns: 0  

>24815 122 216     Xp22.13    chrX:17533854-17533733 BLAT!
AAATGTCCAGTGCTTAGAAGAGCATCTGGCAGGTGTGAGTGCTCAATAGATGTTAAGCAT
TATAATTATCCAAACCATGTTAACATTTTAGTCATTTTAAAGGATCCTAAAAGGTTTTCC
AG


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>25437 127 216     4q21.23    chr4:84179552-84179678 BLAT!
AATATGGAATGTGGGAAAAAGGAGTCATGGTTGATTCCAAGGTTTTGGTCAGAGCAAAAG
GAAAAGGAGATGCCATTAATGAGATGGCAAGAAGGGTGGGAGGAGGAGGTTTGAGGCTGA
GATCAGG


invisible?    
Gene introns: 0  

>32483 145 216     7p14.1    chr7:42342474-42342330 BLAT!
ATCAGGAAGACTGATCTGGATTGATGGAGACTGAAGAGATGGAATAACTAAATGGAATTG
CATCATCCTTGATTGGATCCTGGACTTTGAAACCCACTTAACACACTCTAATGAGCATTT
TTGAGAACACTTGGAAATACTGAAT


invisible?    
Gene introns: 0  

>9236 108 215     6q22.31    chr6:121060611-121060504 BLAT!
GATTAGCACTTTTTGTGTCCTGTCTTATAAACGAGCCTTTGCCTCCTTCTAGGTTATGAA
GATATGTGCTTAAGTTTTCTTCTAAAAGTTTTATTGCTTTACCTCTAA


invisible?    
Gene introns: 0  

>10485 115 215     8q23.1    chr8:109208520-109208634 BLAT!
AGTGATCTTTCATGGTCCTCATGTATTTTTCGTTTAGTGCCATACCATAACACCATGGAG
CCCATAAAAAATGCCGCTAGTGGTCCTGGAAGTGGTCCCAAGAAGCAGAGAGAAG


invisible?    
Gene introns: 0  

>13788 115 215     3p24.1    chr3:27793059-27793173 BLAT!
ATGCTTATATTCTGAATTTTGAGAATGCCGGTCTTTTTCTTCTATCTTATTCCAGAGACT
TGCAGTCAGGCCCATGTCCATGAGGCAGGAGATTTGTCACCCCTTCTCTGAGGAA


invisible?    
Gene introns: 0  

>13815 109 215     3p22.1    chr3:39610432-39610540 BLAT!
CTCTCTCTCTCTCTCTTGCTCTCTGTCCTTAGTTTGCTTTCTGGAAACCAAAACTGCTGG
AAATGCAGAAATGCTGTTGATGAAATCTATTTGGTAAGGGCAGAAAATT


invisible?    
Gene introns: 0  

>23787 115 215     10p15.3    chr10:2842329-2842215 BLAT!
ATCTCACACCATCCTCCCATGGTTAAAGGAGCAAGGCAGCTCCCTGGGGTCCCTTTTACT
AATCTCATTCTTGAGAGCTCCATCTCATGTCCCAATCACCTCCAAAAGTCTCCAC


invisible?    
Gene introns: 0  

>24092 111 215     4q22.1    chr4:92149899-92149789 BLAT!
TCTTATTTTTTTGCTATGAGGTGAAGGTGGCAGATTCCATTTATTCCATCTGTAATCAGA
AATCAAACAATACAAAAGTGTTTATAGTCCAGGCTTTAATTTCATGAAATA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>5496 103 214     6p24.2    chr6:11387025-11386923 BLAT!
ATCCCAAAAATCACTTTATCAAATGGCAAATAGATCTTTAGTATTTGATCCAGGAATCTC
TACCCAGAGGTAAATCAGCTGGATGTGAATCCACATTTCTATG


invisible?    
Gene introns: 0  

>9560 109 214     15q25.1    chr15:79776355-79776252 BLAT!
TTTCTCCCACTTTTCTTACCTTCTTAACTGAGCATTTTCATATTCCATATTATGTCCTTT
ACTAGATTATTAGCTATACTTCTTTGTTTTACTTTATATTGATTTTTCT


invisible?    
Gene introns: 0  

>15846 128 214     2q36.3    chr2:226774774-226774901 BLAT!
CACTTTGGGAGGGCTAGGTGGGTGGATCACGAGGTTAGGAGTCTAGACCAGCCTGACCAA
CATAGTGAAACCCCATCTCTACTGAAAATACAAAAAATTAGCCAGGCGTGGTGGCAAGTG
CCTGTAAT


invisible?    
Gene introns: 0  

>16933 123 214     9p21.1    chr9:30773422-30773300 BLAT!
ATGACCAAATTTCCTGTCTCTTTTTAGTATGCGAGTTTTGTTGTTGTTTAGTGAATGGAT
GTTGAATTACATCAAATTGTTTTTTTGCATTTAAGTTGGTTACATAATTTTTCATCCTCA
CAT


invisible?    
Gene introns: 0  

>4121 127 213     13q21.33    chr13:72847628-72847754 BLAT!
GGAATACTTTCCACTACCACATACACAAATGTAGAAAATAAATAACTCACTATATTCACA
TAGAGTGCAACAATTCATAAATATTTGTTCAGAGAGTGAGGGGAACTTTAAAATAAGAAT
ATGGGCT


invisible?    
Gene introns: 0  

>10261 100 213     4q35.2    chr4:189630828-189630729 BLAT!
AGCCATACTCTCTGTCTCCAGCTTCTTTCCTCCTGTTCTCTTTGAGGACACTGCAATCAG
CTGGATATGCTTTCCACTCCACTGAAACCATCGGCAGGGG


invisible?    
Gene introns: 0  

>12308 130 213     6q14.1    chr6:77948250-77948379 BLAT!
CATTTGGGTGTGTTACTCCAGCCCCTTTATTGAGTGACTTGGACTATCCAGATGAAATCA
GTCTACTACTCCACAACAGAAGTAAAGAGTATGCATGGAATACAGGAGATCCATTAGGAC
ATCTCTAAGT


invisible?    
Gene introns: 0  

>20920 103 213     4p11    chr4:49646478-49646554 BLAT!
AATGGAATGGAATGGAATGGAACGGAATGGAATGGAATGCCTTCAAACCGAATGGAATGG
AAAGGAATGGAATCAACACGAGTGGAGTGGAATGGAATGGAAT


invisible?    
Gene introns: 0  

>27050 113 213     Xp21.2    chrX:29459245-29459357 BLAT!
AAAGAACCCATCCTACAAATATGCCCAGCTACCTACTAGACATGTTCACTGGAATATGTC
CATGTTACCCTAACATCTCCCCTCCTTTATGTTGTGTCCTGTCTCCTATCCCC


invisible?    
Gene introns: IL1RAPL1 (28605680 - 29974017)  

>29504 119 213     16q21    chr16:59165847-59165729 BLAT!
ACTAGGAAACAGAATTTTAAAAATCATTCATCATGATCCCATCATGTAGGATTTTTCCTG
GGGTGCAAGAATGGTTCAACATATGCAAATGAACAAATGTCATATACCGTATTACAGAA


invisible?    
Gene introns: 0  

>29658 114 213     6p22.3    chr6:16073541-16073428 BLAT!
CATCATTCAGAATCTCTGACCATGCTATGCAGGCATTACGGTTGACCCATGAACAACCTA
AATTTGAACTGCATGGTTCCACTTATACACGGATTTTTTTCAACCAAGTAGATG


invisible?    
Gene introns: 0  

>30225 104 213     18q22.1    chr18:63242313-63242416 BLAT!
AGAAATTCAGCCATACAAAAATTAGCTAATTGGCACAAGCTCACATAGCTAGAAAGCGGT
TGTTGCGGTTTGGACATATCCACTAAAAAATCCAAGTGTTGCTA


invisible?    
Gene introns: 0  

Shown 2701-2730 from 3142 sequences on 91 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs