Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2731-2760 from 3142 sequences on 92 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>31668 107 213     14q21.1    chr14:41266733-41266627 BLAT!
AAGGGACTTTCCCCCACTTTGTCCTGCATTTCTCCGTGCTGCCACCATGTGAAGAAGGAT
ATGTTTGCTTGCCCTTCTGCCATGATTGTAAGTTTCTTGAGGCCTAC


invisible?    
Gene introns: 0  

>32305 127 213     Xq21.1    chrX:81063815-81063689 BLAT!
GGGACCATACTCAATAATCCTCTCTACCCCCACTATAGTTAAAGTAGTAGGAGTAAAATC
CTAAATTCACCACACCCAAGTCAAACCTTAAACAACTCCTAAAAAGCTTACAAAATCATC
AACTCCA


invisible?    
Gene introns: 0  

>32687 124 213     1q31.1    chr1:189961695-189961797 BLAT!
TGCTGCTCTTCAAATTCCTGACTGAATCCTTCAGGAAGTGCATCATCTGAAAGGTTTAAA
CAGAGCCAATCCAAGGCAGAATGAAGGTCACCTCCATATAAGAGTGTATTGGTCATGGCA
TCTT


invisible?    
Gene introns: 0  

>11900 122 212     2q22.1    chr2:138785741-138785862 BLAT!
TTAAATTCATGACCACTAATCTCAAGTGGGCTCTTAATGTTAACTGGAAAATATATTTCC
ATATCCATTTCTCTCCCACTCTACCAGTGGAGTATGTCATATTTTTAGTTCTTTCCTTAA
AT


invisible?    
Gene introns: 0  

>23503 115 212     2q37.1    chr2:232685083-232685197 BLAT!
TGTCTAAAAATTATTTAATACTCCTCCTGTAAAAGGTAGAGCCTGATTCCTCTCCCCTTG
AATATGGGCCAGTCTCTGTGACACACTTCTATTGAGTGGAATGTGGCAGCATGAT


invisible?    
Gene introns: 0  

>25695 124 212     5q15    chr5:97499954-97500077 BLAT!
AACCTCACAGGCCATTCTGGGAGTTATGTGGCCAGGCAACATCCTGCATGATCAACCCCA
ATTCTTACGTGAACTGACCTTAGATTGCTCTCTAGCTGCTTAGAGGTGGAACAAGGCTAT
CTGT


invisible?    
Gene introns: 0  

>27313 106 212     4q35.2    chr4:189630734-189630629 BLAT!
CAGGGGCACCAGTGACCTTCATGTGGCTAAAATCAGTGATCAATTCTCAGCCCTCAAATT
ACAAATTACTCTTTCATATCAGCAGCATCTGATGCAGTTAATTGAT


invisible?    
Gene introns: 0  

>14603 119 211     4q31.23    chr4:150125856-150125974 BLAT!
TCTCTTGGATTATACATTATATTTTTTATGTTGAGCATCTTTCTATTGCTTTTCTAAATA
TGGCAATGCCAAACAATAAGCAGACTGAAAATATAAATGTTTAGTTTCATGTATTGGCA


invisible?    
Gene introns: 0  

>15441 119 211     4q32.1    chr4:157482207-157482089 BLAT!
GGGGCAGATTTCCATCTTGTTGTTCTCATGATGGAGAGTGAGTTCTCACACGATCTGATG
GTTTAAAAGTGTGTGGCAATTCCCCCTTTGTGTTCTCTCTCTCTTACTCTACCATGGTA


invisible?    
Gene introns: 0  

>16554 101 211     10q25.1    chr10:108112933-108113033 BLAT!
AAAAAAAGATCAATTTATAGAACATGTAAAATAACAAAACAAGGCGGGGTGCAGTGGCTC
ACGCCTATAAGCCCAGCACTTTGGGAGGCTGAGGCAGGGGG


invisible?    
Gene introns: 0  

>24317 134 211     12q12    chr12:39529510-39529377 BLAT!
GTGCAAAAGCAAGCAACCTAATAAAAGTTTTTGCATAGTGGCAAAAACTGCAATTACTTT
TGCACCAACCTGATAGATGGGCATGTGTTCTCTACTTTGTCTCAGTCTTCACCCCTCCTT
ATTGTCATATACAG


invisible?    
Gene introns: 0  

>26970 111 211     3p12.1    chr3:85570833-85570943 BLAT!
AATTTAAAACCCTGTAGCTAATTTACATATTCCGTGAGTTTATTGAATTCGTTCACATTT
GACGGGTGAGGGAATTGTGGCAGAGAATTTAAGAGATTTACGGAAGGTCAC


invisible?    
Gene introns: CADM2 (85008132 - 86123579)  

>11262 101 210     1q44    chr1:247993765-247993665 BLAT!
TGCCTTCTTCCTGGGCTTGCCTCAGAGATAAATCCAGATCTATTCATCTCTCTTGGGAAG
GAGATTGTCGAAACGTCAAATGCCTCAAGTTTTACCGCTCC


invisible?    
Gene introns: 0  

>12430 106 210     12q12    chr12:39529490-39529595 BLAT!
TTAGGTTGCTTGCTTTTGCACCAACGTAATACAAGGAACAGCCACTGCTCAGCATTAGCC
AATTGTAGCCAAATGGAAATGAAAGTTACACAGATCTGATTTTTCA


invisible?    
Gene introns: 0  

>12931 135 210     4q12    chr4:55688948-55689082 BLAT!
CTTGGTTGCTTTCAATTTTTGGAAAATATAAATAAAGCTGCAATAGCCATCTGCGTGCAA
GTTTTTGTGTAGAGATAAGTTTCAGATTAATTTGGGTAAACACCAAGAAGCTCAATTAGT
GGATTGCATGATAAA


invisible?    
Gene introns: 0  

>16271 110 210     2q36.3    chr2:227178166-227178275 BLAT!
GCCAGGTTTACTGTCCCTTTCCCTATGGGTTAGATATTCATTCATTCATTCATTCATTCA
TTCAAAGGATATCTATTGAGCATCCACTCTGTGTCACGCACTGTGCTAAG


invisible?    
Gene introns: 0  

>19321 143 210     3q23    chr3:141961356-141961214 BLAT!
AAAATAAGGTTGTTGCCTTTCCTTCTAGTATAGGGAGAATGTCTTTCATACGGGAATTTC
ATTTTCTGTGCTAAGAAACAGTGTGAAGATCAAAGTGATCCTTTTTGCTCCTGCTCTTCT
TTAAGTGTTTATAATTTTAAAAA


invisible?    
Gene introns: 0  

>21755 104 210     21q22.11    chr21:31696440-31696337 BLAT!
ATTCCTGGGAGGCTAGGATGATTCAACACATGCATATCAATGAATGTGATACACCAAATT
AGCAGAAAGAAGGATAAAAGTTATCATCCCTATGGATGTAGAAA


invisible?    
Gene introns: 0  

>23528 133 210     8p23.3    chr8:1932728-1932596 BLAT!
GTAATCCCAACACATTGGGAGGCTGAGGCGGGAGGATCGCAAGGTCAGGAAACTGAGACC
ATCCTGCCTAACACGGTAAAACCCCGTCTCTACTAAAAACACGAAAAATTAGCCAGGTGT
GGTGCGGGCAGCT


invisible?    
Gene introns: KBTBD11 (1922043 - 1955109)  

>24305 116 210     Xp11.3    chrX:44530801-44530916 BLAT!
ATGTTGTCCAGGCTGGTCTGAAACTCCTGGGCTCAAGAGATCTGCCCACCTCGGCCTCCC
AAAGTGTTGGCATTACAGGCGTGAGCCACAGCACCCAGTCATTGGTGACTATCTTA


invisible?    
Gene introns: 0  

>30831 114 210     22q12.1    chr22:28910578-28910465 BLAT!
TAGCTGCCAAGAGTGAACACTCCGTGTAAGGTTTTCTCTTCTTAATTCTCCAGCTTCCGG
CCTTTTGTTGGCTCTCAAAAGTAGTCTATTCAGAAGGCCTTATTCAGCATGTTC


invisible?    
Gene introns: TTC28 (28374001 - 29075853)  

>32656 104 210     4q31.23    chr4:149530950-149531053 BLAT!
TAAGAGTTTTATCGTTTCTGGTCTTACGTTTAGGTATTTTACCGATTTTGAGCTGAATTT
TGTGTATGGCATAAAATGTAAGTCAAATTTCATTCTTTTGCACG


invisible?    
Gene introns: 0  

>10608 124 209     11q14.3    chr11:90691633-90691510 BLAT!
TGATTTGCATATATTGAACCAGCCTTGCATCCCAGGGATGAAGCCTATTTGATCATCGTG
GATCTTATTTCTCCTTTGCTTATGCAGCTTAGTTTGACTAGAAAAAAATTCTTGGATGGA
ATTT


invisible?    
Gene introns: 0  

>13383 113 209     6q21    chr6:107136015-107135903 BLAT!
CAGCACTGGTTAAAAATCTGTAAAAGAGTTAGGTTGAATGCTCTGTATGTCCTCTGCTTT
AAAGATTCATTCTTTAAAGAGGCTGAATCTTGGGGACTCCAGGGTTGACGACA


invisible?    
Gene introns: 0  

>18739 124 209     3p24.2    chr3:26026008-26026131 BLAT!
ATAATTCTTATGAATACCCTTTGGGGAAGACTACTTTCAACTCAACTGTTGTTACTTTTT
CCCTTCTATCCCCTAATCCACCGTGTCTCTAAAATAATTGTGCAGTTACTGGTTTCCAAG
TATC


invisible?    
Gene introns: 0  

>24180 127 209     7p14.3    chr7:30202737-30202863 BLAT!
TCTATGACATGACACCATGTCTCCACCACCTTCCTCCCGGTTATTTATTCACCAAACATG
GCATTTAAATAACTCATCTGGAAGTTGATGGTAAGTTCTGTTATTTGATTAAGAGCCAGT
TTCTTTC


invisible?    
Gene introns: 0  

>30677 125 209     2p16.1    chr2:58126871-58126995 BLAT!
TGCATGCACGTTTAATATTACACTTACCTTGTCACAAAACATTTCAATAAGGAAAGTGAG
TGCTTAAAGTGCAGACCCACAATAGGCAGAGAGCTGGCAAACGAGTCTGAAAATTGGGTG
AAGGG


invisible?    
Gene introns: 0  

>5918 121 208     Xq25    chrX:124345865-124345745 BLAT!
ATTTATGTATTGATTCACTTAAAATAACAGTAATAAACCCATTACATGTTAACATAAATA
GTATCTTCATGAAAAATTGCTATATTTTGTGAAACAAAAAATTATTGAGCAGCCATTAAA
A


invisible?    
Gene introns: 0  

>15275 116 208     4p15.2    chr4:22667519-22667403 BLAT!
TCACACCATCTATAAAAATTAACTCAAAAATGGATTATAGACTTAAATATTGGAGCTAAA
GCTATTAAACAATTAGAAAAAAAATAGAAGGTAATCCTCATGACCTTGGATTAAGC


invisible?    
Gene introns: 0  

>20268 123 208     8q22.3    chr8:105311329-105311451 BLAT!
CAGAAGGCGAGAGGATCACTTGAGCCCTATTGTATCTCTTTGAAGTCATCTGGACTGGGT
TTCCTTATTTTGACTAAAAATGAGAGGGCAAGTTCATCAGGGTCTCTGCTTTGAGATGCC
ATC


invisible?    
Gene introns: 0  

Shown 2731-2760 from 3142 sequences on 92 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs