Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2761-2790 from 3142 sequences on 93 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>20804 127 208     9q21.32    chr9:86161191-86161065 BLAT!
CAAGTGATTTTCATGCCTCAGCCTCCTATGTAACTGGGATTATAGGGGCTTACCGCCATG
CCTGGCTAATTTTTGTATTTTTGGTAGAGATGGCATTTCACAATGTTGTCCAGGCTGGTC
TCAAACT


invisible?    
Gene introns: 0  

>21156 116 208     Yp11.2    chrY:5442294-5442409 BLAT!
AGCGGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATC
TTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACC


invisible?    
Gene introns: PCDH11Y (4924130 - 5610264)  

>28806 116 208     8p12    chr8:34358872-34358987 BLAT!
GTCCCCAGTAGGAATTCAGTTTTTGCCTAACAGCTGAAAGGGATCATGAAAAAACAGTAA
GTTCTTCAACATCATCAGTTACCTGATTCATATTTGCACATATGTAATTCACTCCA


invisible?    
Gene introns: 0  

>28890 119 208     11p15.1    chr11:20229120-20229002 BLAT!
AAATGCCTGTAATCCCAGCTACTCGGGAGGCTGAGACATGAAAATCGCTTGCACCAAGAG
GCAGAGGGTGCAGTGAGCCGAGATCGCGCTACTGCACTCCAGCCTGGGTGACAGAGTGA


invisible?    
Gene introns: 0  

>32123 110 208     5q14.3    chr5:84746090-84746199 BLAT!
AACCAGAAATGATTTGTGTGTTTTCTTGAGGCAATGTCTATTTGTAGCAGTGTTAACATT
GACATCAGTAGCTAGAAAATGACAGCAAAAGACAAATGATCCTCAGGTGT


invisible?    
Gene introns: 0  

>5627 106 207     8q24.12    chr8:119904686-119904791 BLAT!
TCCGCCATGATTGATAGCTCCTTGAAGCCTCCCCAGAAGCAGAAGCTGTTTTGCTCCCTA
TACAGCCTGCAAAACTGTGAGCCAATTAAACCTCTTTTCTTTATAA


invisible?    
Gene introns: 0  

>15633 127 207     7q21.11    chr7:85720979-85721105 BLAT!
CAGGTCCTGAAAGCACAAGTAAGTTACATGAGTAAGTGACTCAAATGCTCATGGTCTTCA
CTCCTGTCACCCTACCTTCTCTCCACCAGCCTGCACCAATGGCCTCCTGGGGAGTTCCCT
ATGATCC


invisible?    
Gene introns: 0  

>21583 123 207     5q21.3    chr5:106659418-106659540 BLAT!
GCTAGTCTGTTTACAAACGTTTCAGTGTCAGCTCATTCACTCCGCGGGTTTATGCAGCCC
AACTTTATGTTAGTAAATTGGGGAAATTGGTTTCCTCTGGTAAAAAACACTTCCACTTCA
AAG


invisible?    
Gene introns: 0  

>23476 105 207     11p11.2    chr11:45332647-45332751 BLAT!
TGGTAGGTTAGTTATGGTTTCTTATTGTGCTTTTATTTTGCATTCCCTAGTAATGAATAA
AAGTCAAATATCTGGCCTGGCACAATGGCTCACGCCTATAATCCC


invisible?    
Gene introns: 0  

>32139 123 207     6q22.1    chr6:117285016-117284895 BLAT!
TAACTTCCTATATCCAACCCAGGTCTATGTTTCATGTCCCAGCTACATGCTGCCCATAGC
TCCTGCATGCTCCTCAACAAGGACAGCCCACTGTGCTCTACTTCTGTTTATTTTGCTGTC
TCC


invisible?    
Gene introns: 0  

>3422 142 206     Un_gl0002210    chrUn_gl000221:116768-116909 BLAT!
CATGCCTTTTTATATTAACTGAACAATATTCAGCGTTCCATTTTAATTCCTTTATTGGCA
TTTTAGAAGAATATCTTCATATAATGTGGTGGTTCTCTAGGGATTATAATAAACATCCTG
GGCTTATCGCAGTCCACTTAGT


invisible?    
Gene introns: 0  

>6549 127 206     9p21.2    chr9:26275939-26275813 BLAT!
AGAAAGGATTCCCTATTCAATAAATGGTGCTGGGATAATTGGCTAGTCATATGCAGAAGA
ATGAAACTGGACTCCTACCTTTCACTATAAACAAAAAATTAACTCAAGTTGGATTAAAGT
TTTAACT


invisible?    
Gene introns: 0  

>11501 127 206     12q12    chr12:39437817-39437943 BLAT!
GCTCATGATTTAAAGTATTTTTGTAATGCATAAAACACATTGGATTTTATTATTATTATT
ATGAACAGTCAAGGGATGTATTACTCAGGAAGCACACGGAACGATGCAATAGAGATGAGA
GATTTTT


invisible?    
Gene introns: 0  

>15972 103 206     13q31.1    chr13:82050385-82050283 BLAT!
ACAATAGATTTCAAGTATTTAGATATCATTGTGGTAATGCTATACTAAATTGTAGCTAAT
CAACTTGAAGTATGCTAATCACATTTCTAGAATTACTGTCATT


invisible?    
Gene introns: 0  

>26983 103 206     2q34    chr2:210043947-210043845 BLAT!
AATGACCTCAGGCAACTCAGGATCACGCCAGGCAAACTCCCTGGGGTCCTTCTGAATGCT
GTCTATTGATGGGGATCTTGTGGTGCCATCATCAGCCGGCACT


invisible?    
Gene introns: 0  

>32104 111 206     21q22.2    chr21:40254776-40254666 BLAT!
CAGCCTCTGGAGATCTGGGACCACAGGCATGTGCCGCCATGCCAGGCTAAGTTTTGTATT
TTTAGTAGAGTTGGGGTTTCACTATGTTGGCCAGGCTGGTCTCAAACTCCT


invisible?    
Gene introns: 0  

>32657 102 206     20p12.3    chr20:6194761-6194660 BLAT!
AGTGGTCACATCAAGTGTGTAGCCTGTTCTTTCCAAGAGTGCCTTAATTTTTGCCTCATC
TGGTCCTTTACTAGAATCTGCTACTTTGGTCCCTTGTTTTTC


invisible?    
Gene introns: 0  

>2734 103 205     2q23.3    chr2:154707823-154707925 BLAT!
AGTAGGCAAAATAAGAATTTTTAGAAACACAGAAAGCTAAAACAGTTACCAGAAGACCTT
CACTACAGAAAATGGTATTGAAAATCTTTTAGGTAGAAGTAAA


invisible?    
Gene introns: 0  

>7156 100 205     10q23.33    chr10:95749305-95749404 BLAT!
GAAGAGGATAAGGGACTGGAAATATAGCTGCATCTACTTTTGAAAAATACATTCTGTATT
CTCTCCTGTTTCTTTAAACTGTGCATTTTGGCCACTAAGA


invisible?    
Gene introns: 0  

>9223 112 205     2q31.3    chr2:181751948-181751838 BLAT!
TCCTAAGTATTTAATTTTTTTTGTGACTATTGTAAATGAGATTTGCCTTCTTGGTTTTTT
CTCAGTTAGCTATTCTCTACTAAGAATATCCCATAGTAGATATTCTCTATTT


invisible?    
Gene introns: 0  

>21517 127 205     1p13.2    chr1:111806684-111806558 BLAT!
AAAACATCAGTGAAACAATAAAAAGTTGTTTTTTTGAGAAGATAAACAAAACTGACAAAC
TTTTAGCCAGACTAAGAAAAAGAGACAAAAATAAATAAAATCAGAGATGCAAACGAAGGC
ATTGCAA


invisible?    
Gene introns: 0  

>25110 140 205     10p11.23    chr10:30647923-30648062 BLAT!
CGGTGGCTCACGCCTGTGATCCTAGCACTTTGGGAGGCCGAGGCATGCAGATCACAAGGT
CAGGAGTTTGAGATGAGCCTGGCCAATATGGTGAAACCTCATCTCTACTAAAGTTACAAA
AATTAGCCGGGCATGGTGGC


invisible?    
Gene introns: 0  

>30806 114 205     2q36.1    chr2:225034415-225034302 BLAT!
GAGATTTCTTGAAGAAAAAGAGTAGGTTGGATGATGTGGTCAGTGTCTTGGGAAAGAAAT
GTCATTTTAGCACAAATGTTTGCAATGAAGCAACAAGGATACCAAGGTCACTTG


invisible?    
Gene introns: 0  

>2532 139 204     5q21.3    chr5:107843626-107843489 BLAT!
AGAGCTACTATTCCACACAGACGGGAGATGTGGAGAAAGTTTCCCAGACAGGGAGAACTT
TCACTTGTTCTTGAAGGATGAGTAGGCGTATCCAGGTGATTGCAGAGGAAGGAGAATGAG
AAAAAGAACTCTAGGAGGG


invisible?    
Gene introns: 0  

>3154 100 204     1q24.1    chr1:166530777-166530678 BLAT!
CAATTTCCAATACAAGTGGTGACTGCAGTTGTTCTTTTGGTGTGTCATCCTTGAATATGA
TGCTGGCTCTTGTTTTGAGGAGCATATTCTATATCACATT


invisible?    
Gene introns: 0  

>4624 107 204     3p22.1    chr3:39609936-39609830 BLAT!
ATGTGTTGAAAGCTTCTGGGTGCTACATATGTTAAGAAAACTATTCAAGTCTTCAATTCA
AAAACAAACAGCTCTAAAGTCATTTCCTGGGTCGTTCCATCAGGAAG


invisible?    
Gene introns: 0  

>17388 125 204     5q35.3    chr5:179514321-179514197 BLAT!
TGAATGCTTTGGGAGGCTGAGGTGGGAGGATCACTTGAGGCCAGGAGTTCCAGGCCAGCC
TGGGCAGCATAGCAAGACCGTGTCTCAACAACAACGAAAAAGCATCCAGGCATGGTGGGG
CGTGG


invisible?    
Gene introns: 0  

>19632 104 204     1q42.13    chr1:227563767-227563870 BLAT!
TCATAATCTAATTTTAGAACTTTTTTGTCCCCCGCAGAAAGAAAACCCCATACCCTTTAG
CTACCACATCCTCAAGACCCCATTACTCCCCGCTCAGCCCTAGG


invisible?    
Gene introns: 0  

>13104 109 203     17q12    chr17:33053586-33053694 BLAT!
AGATCCTAGTCTGATGGGGGAGGTAGCTCGGCCCAAAACCCCCCTGTCTGATGGTCAGTT
AGCTTTCCCAATATCTAATAAACAAGCAGAGCTCCCCCAGCCCTGCAGT


invisible?    
Gene introns: 0  

>6065 140 202     2p24.3    chr2:13633739-13633600 BLAT!
AAAAGATAAAAACTTCCAGTTACAAGATGAACATGTTCTGGGAATCTAATGCACAGCATG
ATGACTGTCACTAATTATATTCTATTGTATACTTGAAATTTGCTAAGAGAATAGGTTTTA
AGTGTTCTCACCATACACAC


invisible?    
Gene introns: 0  

Shown 2761-2790 from 3142 sequences on 93 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs