Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2791-2820 from 3142 sequences on 94 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>10509 130 202     4q13.1    chr4:65600539-65600668 BLAT!
ATTTTGGTTACACTCTCACCTAAGTGAAAGCCTGAACAAAAAGGGGGAATTTTTCAAACA
AAATTATGGGAGGCCATTGTTTTGGACTAAGCTCATGCACTAGGTCCCAACAAACCAAAC
CAAACCAAAA


invisible?    
Gene introns: 0  

>17090 125 202     13q21.2    chr13:59748627-59748503 BLAT!
CATTTAATAGATGATCCTTTTATTATTCTTTAATCTGTGATGCCTCTTTTTTTGTGGGGG
AAGGGCAGGGTCTCCCTCTGTGATCAGGCTGGAGGGCAGGAGCACAATCACAGCTCACTG
CAGCC


invisible?    
Gene introns: 0  

>27204 125 202     Xp11.4    chrX:41958260-41958356 BLAT!
CGGCTAGAGACAAGTGAGGTAAGGGGACATGAGACTGCCAAGCTGCTGAGGCTCTCATCT
GTCAGTATCTCCGGTCGTTTCAGCACCACTGCAGATACCCCGCGTACCTGCCCGGGCGGC
CGCTC


invisible?    
Gene introns: 0  

>30278 114 202     16p11.1    chr16:35035317-35035430 BLAT!
AAGTGCTGGGATTACAGGTGTGAGCCACCACACCTGGCCAAACTCCTTCATTTCTTATCT
CACACTCTGGTAATTTTGCCCACAAAAATAGTTCACTCCCCCATACCTAATGCT


invisible?    
Gene introns: 0  

>31809 112 202     13q21.1    chr13:59522294-59522405 BLAT!
AGTAGACCAACAGCAATGTTTTACTGTAACATAATTGATATGGTTTGGTTCTGTGTCCCC
ATCGAAATTTCACCTTGAATTGTAATCCCCATAATTCCTATATGTCAAAGGC


invisible?    
Gene introns: 0  

>14876 134 201     1q41    chr1:219454955-219455088 BLAT!
ACACACAGCAGGTGAGACTGGAGAAGGCTCTTTCTCTCCAAAAACCAAACAGGGGAGAAG
TCTAGGAAGAATGAAAAGTGTCTCGCCTCAATCATACCCTCTCACCTGCTCCCAGGATGC
CAATTGTCAAACTT


invisible?    
Gene introns: 0  

>20536 113 201     5p13.1    chr5:39546220-39546108 BLAT!
GAGTCTTCCCTCAGAAGAGTTTTGAGAGAAATAATTGTTAATATCCTATAGCATCATGAA
ATACTTTGTATATCTGCTCTCAATAAAAAAGAGCTAACATATCAGCTATTTTC


invisible?    
Gene introns: 0  

>26497 123 201     3q13.2    chr3:111896255-111896377 BLAT!
AACCACCACACAGGCTACTTGGGTCTTTCTCCGTGTAAGACTTTGTCTTACTTCCTGCTC
TGCAGTTTCTAGCCAAGTTAGCTTCCACAACTTCTGATGTCTCATTTCTCAGCTTAGCAG
GAT


invisible?    
Gene introns: SLC9A10 (111859751 - 112013074)  

>27205 116 201     14q24.3    chr14:75811239-75811124 BLAT!
TGTTAACTCCCTGGCATTTCTGGCCTTTCTTGAATGTGTTCAGAGTGGGCTCTGGTGGTG
AGAGAAAGCCCTCAGGCAAAGACATGAGGGTGTTAACAGTAGAAAATTAAACCAGC


invisible?    
Gene introns: 0  

>32273 116 201     6q14.1    chr6:83311082-83310967 BLAT!
TGTTCTTTTGTGAAATGAGAGAACAGTAATACAAGAGAAGTGTGGCAGTATTGCTTGGGC
ACTTGGGAGTGTTCTTTGAGATCTGGATCATGAATTGAATAGTAGTTAGTAATGAT


invisible?    
Gene introns: 0  

>10029 111 200     2p11.2    chr2:88509137-88509247 BLAT!
GTTAGAAAGTCTTACATCCAGGCCAAACACCTTCAGTTCTTCCTCTGCCCTCAGGCCTCC
ACTGAGTAGATTTAATCCCTCTTCCACTGTCTGGCCAGCTCAGCCAGGCAT


invisible?    
Gene introns: 0  

>3055 124 199     Xq27.3    chrX:143430978-143430855 BLAT!
AGACTGCCATCCATGGACTCACAGAATGCCTTATCTACCATCATAGTATTCCACACAGAA
TTGCCTCTGACCAAGGCACTTAGTTTACAGCTAAAGAAGTTCACCAGTGGGCTCATGCTC
ATGG


invisible?    
Gene introns: 0  

>7692 104 199     2q12.1    chr2:105974926-105974823 BLAT!
GTCTAGGGCTTTGCCCCAGGTGCGACAGGCTGAGAATCGTAGAGCTCCAATTGCCCCTAC
CCTAGCCTGCTTAGTGCGGAGGCTCCACATTGGGAGGGGCAATC


invisible?    
Gene introns: 0  

>11261 101 199     2q21.2    chr2:135038482-135038382 BLAT!
ACCATCTGCTACATGCCTGGCCCAGGAGTGAAAACCTGAGTTGGACACTTAAGAAGCGTA
TGAGGCAATAGCCAAAGCTTACGGAGCTCTTATTTTGTGCC


invisible?    
Gene introns: MGAT5 (135011829 - 135206468)  

>15246 113 199     9q34.11    chr9:132139427-132139315 BLAT!
AGGTGGGAGGATTGCTAGAGCTCAGGAGTTTGAGAACAGCCTGGACAACACAGTGACACC
CCCCATCTCTACAAAAAATAGAAAAATTAGCTGGACATAGTGGCACACACCTG


invisible?    
Gene introns: 0  

>31142 105 199     3q25.1    chr3:150112576-150112472 BLAT!
TTTGAGGTTGGCTGCTGCTAATTCCTCTCCTAGAGAAGAGGACACTCTAGTTCTAGCCCC
AGCTCTGCAACTGGCAGATCACCTCAGCTCTCTGGGCCTCTGTTC


invisible?    
Gene introns: 0  

>33160 121 199     20q13.12    chr20:42737005-42737125 BLAT!
CTAGTGAATTATTGAGTATGAGGATAATCATAGGAACCCCCTTGTTTGTAGCCAGTCAGT
ATGAACTGATGGTGGCCCTGGAGATCCCCAAACTTGTATCTGGGGTCTGAAGGGAGAGGG
G


invisible?    
Gene introns: 0  

>3396 118 198     9q31.1    chr9:103447660-103447543 BLAT!
GAAAAGCAAGTAGAATGATTGGCAGCAGTCTACAAATTCTATCTTTTATCAGTAATGGAT
GTCAATCAGTGTAGGGTGAGCCAACCTCCTTCTCTCCTTGAGGTCCTGCCCAGATTCA


invisible?    
Gene introns: 0  

>3643 105 198     5q14.3    chr5:82901859-82901755 BLAT!
GTCTCTTCATGTCCTCTCCTCTTCTCGTAAGCATTCCAGTCCATGAATTTTGGGTTCATC
CTAATTTAATACGACCTTAGCTGGATTACATCAGAAAGAACCTAT


invisible?    
Gene introns: 0  

>7324 121 198     7q31.1    chr7:108731819-108731699 BLAT!
GTTCATTTTCACAGAGGCGTAGTCTGTTCTGTTCTGGTCAAGGACAGTGCCAGAAAAGGT
CATGAAGACTCCCCTGAGGAAGTGAATACAATTCTAACGTAGTAGGAAATTCACTTGTTT
C


invisible?    
Gene introns: 0  

>8284 112 198     1p21.1    chr1:106268147-106268258 BLAT!
GATGATACACCTGCACCCTCACTGCAAAACAAGCAGAGAACATGAGTATATGTCCTCTAT
ATCAAAATACGGACTCTTGCAGAGGAGAATCCTGAAACACTGAAAGTATGTT


invisible?    
Gene introns: 0  

>13904 126 198     7q22.3    chr7:105766697-105766822 BLAT!
TTTGTGTCTGCTAGTTTCGATAAATCTATTCGAATCTTTCCTGTAGACAAAAGTCGAAGC
AGGGAGGTATATCATACAAAGAGAATGCAACATGTTATCTGTGTAAAATGGACTTCTGAC
AGCAAG


invisible?    
Gene introns: 0  

>23380 107 198     4p15.33    chr4:12727539-12727433 BLAT!
AGAGAATGCAAACTCATAGGCAACCTGTCACTTATGTTGATTTTGTCCCTGGTGTATAAT
TAGGCTCCCTGCATCTGATGCCACTCCCCTTGTTTCTCTGCCTCCCT


invisible?    
Gene introns: 0  

>5475 128 197     4q32.2    chr4:162057112-162057239 BLAT!
TGTAAAGTTAACTCTCCCCTCTTTCTGTATTAAGCCCCTCTCCCATAGTTAATCATTTTT
CTTCCTCTTCAATGTATTTCTGTCATGTTTCTATTAACAAATTGTATTTGTGTTCCCTTA
AATGTGAT


invisible?    
Gene introns: 0  

>8830 100 197     3q22.1    chr3:132106269-132106171 BLAT!
GGAGCAGGCTAAATGTGTGCCACTGGAACCACAACACTGACAGCGCTTTATTTCCCATTT
GCTATCAGGTGCATTATAGTCTCGCCCTTCTTTGCAACGA


invisible?    
Gene introns: 0  

>11352 109 197     5q34    chr5:165738711-165738819 BLAT!
TATTAAGAGATGCCAGGTGTGGTGGCTCACGCCTGTAATTCCAGCAGTTTGGGAGGCCAA
GGTGGGCAGATCACTTGAGGCCAGGATTTTGAGACCAGCCTGGCCAACA


invisible?    
Gene introns: 0  

>18565 133 197     Un_gl0002110    chrUn_gl000211:153017-153149 BLAT!
AGAATCTAAATCAGCCTTTTTTCACTATGCAGCAGAACTGTGTTTCTGGACTGCTACCAG
TTTGTCAGCTGAACAGTTCTGGCTGCAGCTTCTCTGATGAAGGATAGCACAGCCCCTCAC
TCTCAGTGCTCAG


invisible?    
Gene introns: 0  

>21809 106 197     8q23.1    chr8:108166911-108167016 BLAT!
TACCATTATATGTAGGTCAGGAAAGCATATTATTGATCCATTTGGACACCTCAGCCAAGG
ATGTGAACGTTCCCTGGGGTGAGCTAGTTTAATCTGTATTTGCTTC


invisible?    
Gene introns: 0  

>22237 108 197     5p13.1    chr5:40565867-40565974 BLAT!
CCGCTGTTAGTCTGATGGGCTTCCCTTTGTGGGTAACCCAACCTTTCTCTCTGGCTGCCC
TTAACATTTTTTCCTCATTTCAACCTTGGTAAATGTGACAATTACGTG


invisible?    
Gene introns: 0  

>4024 129 196     13q21.31    chr13:63589614-63589486 BLAT!
ATGGTTATTATTACAAAGTCAAAAAATAACTGATGGTGAGATTGTGGAGAAAACCAAATG
CATATACACTGTTGGTAGGAGTGCAAACTATATCAGCCATTGTGGAAGGCAGTGTGGTGA
TTCCCCAGA


invisible?    
Gene introns: 0  

Shown 2791-2820 from 3142 sequences on 94 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs