Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2821-2850 from 3142 sequences on 95 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>6976 105 196     7q36.1    chr7:149867990-149868094 BLAT!
ATATAGGTGTCAATCCCTCAAGAGAATATAATAACCCTAAATGTTTATGCACTTAATAGC
AGAGCTTCAAACTACATGAAACAAAAACCGATAGATCTGCAAAGA


invisible?    
Gene introns: 0  

>7646 124 196     11p15.4    chr11:3257199-3257322 BLAT!
GTGACATAGCACAATCCTGACTCTACAAAAAATACAAAACAAACAAACAAACAAACAAAC
AAAACAAAATTGTCTAGGTATGGTGGTGCATGTCTGTGGTCCCAGCTACTCAAGAGAGGG
AGGC


invisible?    
Gene introns: 0  

>8709 101 196     1q23.3    chr1:164946685-164946585 BLAT!
AAGAACATTTTTCACTGACAGCTATTTTCCTCCAAAATTGTATGCTCTATATCTTGCTTT
TGCACTCATGTTATTATCAATAGTATTAGTGAAAGTGGTAG


invisible?    
Gene introns: 0  

>10932 132 196     2q37.1    chr2:235515190-235515059 BLAT!
GGTCACTGGCTTGGGATGACCAAGCCCTTTCAAAAGGTCCTTCTGAAAAGTTAAGAGATA
GCACAGAAACCTGGTTAAAATGCAGATTCTGATTCAGTAGATGTGGCTGAAGTCTCAAGG
GGCACCAATGCC


invisible?    
Gene introns: 0  

>13850 101 196     2p23.1    chr2:30131316-30131416 BLAT!
AAGTAAAAAGCTGCACTCTCTCCAAGACCCTATTCTCAAATTACCTCCTTCTGGAAGTGT
TTTTATTTTTTACTCACTTCTATCTCAGTCTCAAAAGGAAA


invisible?    
Gene introns: ALK (29415639 - 30144432)  

>19545 117 196     14q31.2    chr14:84423335-84423219 BLAT!
GCTGCACCTTGTGGGAGGTCCTTCTTGCTCTTTCTGCTTCCTCTGCTTTGTCCTTGTTAG
TAAAAACTAAAAATGCCATATCCAAAAGCTGTTCCTTAGGAGCTTGGGGACACATAG


invisible?    
Gene introns: 0  

>19865 102 196     Xp11.23    chrX:48634902-48634802 BLAT!
CACCCTGGAACAGTTACAGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGC
AGGGAATGCATCGGGTGTAGCTGATGGTGCTGGAGCTGTTAT


invisible?    
Gene introns: 0  

>22524 113 196     9p13.1    chr9:40500513-40500625 BLAT!
AAAAATAGAAAGTTACTTTATTTCATATAAAAATGAAACAATGATGTCCCATGAGGCATA
TTTACTTTATAACTTTTTATGCATAATAAAAATTACTATATTAGGCTGGGTAA


invisible?    
Gene introns: 0  

>27134 101 196     10q26.3    chr10:135386891-135386991 BLAT!
CATATTAAGACGTTGTAGAAAGCCATAGTAATAAAACAACCAAGTCTTTGCAAGGATTAG
ACAGAGACCAACACGAGAACAAGGATACCATTAAGAAGCTC


invisible?    
Gene introns: 0  

>27302 131 196     1q44    chr1:244763183-244763313 BLAT!
TCAGCTTTGGGCTGGAAAATAGAAGAAAGAGACAGGAATTTACCTATAGAGAAAAACACA
AAATATGACCTGGATTTTTTTAAAGAGGAAGATAGATGAGTATGTTTACAGTTTGAGGAT
AAAGAAAGGAA


invisible?    
Gene introns: C1orf101 (244624672 - 244803662)  

>3444 110 195     5q22.3    chr5:114330678-114330787 BLAT!
GGGATAGCACTTGGAGTCTACTCAGATGCGTGGGACAACCACACAACCAGTGGCATACCT
AAGTAAGGAAATTAATGTAGTAGCAAAAGGCTGGCCTCACTGTTTATGGG


invisible?    
Gene introns: 0  

>3484 108 195     5q11.2    chr5:57113545-57113438 BLAT!
ATGCACTGAGTCCACTTACACTTCCACCTCCTGCGAACCTTTCAACTGAACAGCAACATC
ATACATCTTGGTATCGGTGAGGTGCCTCTTTCCCATTGTTTCTGGCTT


invisible?    
Gene introns: 0  

>3589 100 195     5q23.3    chr5:128613776-128613677 BLAT!
GCAAATGGCTGTATTAGCTTCTAATTCAATAGAAACACATTGGAGTCTCCTGGTGGAAGC
ATTCTTTTGGGGGAGTAATAAGATCCAAACTGGCAGATCC


invisible?    
Gene introns: 0  

>6888 109 195     Xq26.3    chrX:135057341-135057233 BLAT!
GCCACAGGAAATAAATGCCTATCTAGTAGTCAGAGATGCAGCCCTGGAGCTAAGGAGAGA
TATTTGTGATAGAGATGTCGATTTGGAATCACTGTAATACCTTTGCTGG


invisible?    
Gene introns: 0  

>14509 126 195     13q22.2    chr13:75709017-75708892 BLAT!
AAACTGTCAGTGCTATTTTGCCTTTTATGACAATATTAATACAAACCAAGGAGACAGGGA
CTGAGTCCTTCCCACCAAATTAACACAAAAACATTCTTTCCTTTGTGAACTGAAAACAAC
TACAGG


invisible?    
Gene introns: 0  

>15923 101 195     1q23.3    chr1:161348185-161348085 BLAT!
AACAGCATCTTTAAAACTGTGTAGCTACCTCACGACCAGGCCTGTTTATTTATAATGCTG
GTGGTATCACCTTTTGCCAGCAGGCTGGCTGGCTGTGGCTT


invisible?    
Gene introns: 0  

>18515 106 195     5p13.2    chr5:34476371-34476476 BLAT!
CTCTTTGCTAGTTTTCTTTTCTGACATCAAACTCTATTCTCCTCAATGGATTTAAGCATC
CATAAACAAATGTTAAGAGGAGATGGTTTGAAAGCAATACCTGCTT


invisible?    
Gene introns: 0  

>30199 116 195     10q23.2    chr10:89222626-89222741 BLAT!
ACTTTAGTAGGAATAGCATTGAATCTGTAAGTTCTTTGGGCAGTATGGCAATTTTAATAA
TACTGATTTTTCCTATCCATGAGCATGGAATGTTTTTCCATTTGTTTGTGTCTTCT


invisible?    
Gene introns: 0  

>4383 104 194     7q31.31    chr7:119644330-119644227 BLAT!
AAGCAAAACCAGAGGCATGACATTACCCAATTTCAAAATCTACTACAAAGCTCTAATGAC
CAAACTTGCATGATACTGGCATAAGAACAGACACATCAATCAAT


invisible?    
Gene introns: 0  

>21126 111 194     11p14.3    chr11:24063710-24063820 BLAT!
TAGTTTTTGATCCAAGAAAGGAGAGATTGGCATACAAGGAAATGGCACCCTTCAGACTTA
ATGTTAGTGAGTTTGTTTAACTTTGTTATTTGTAAAGAAGAAAAAGGAAAA


invisible?    
Gene introns: 0  

>21698 118 194     11p12    chr11:38078696-38078576 BLAT!
AAACTGGCAAAGACTTCATGATGAGACACCAAAAGCAATTGTAACAAAAGCAAAAATTGT
CAAGTGAGATCAAATTAAAGAGCCTCTGCTACGGGGAAAAAAAAACGGAATAAACAAC


invisible?    
Gene introns: 0  

>25834 100 194     10p12.1    chr10:25936256-25936157 BLAT!
AAAGTCAAAATTGAAATGAATGCACATAGAATTGTATATAAATTAGCACCTCTGCAACAG
TTAATAAGGCTAATACAATCTCATTTTTACTGTTTGTATT


invisible?    
Gene introns: 0  

>26464 107 194     2q21.2    chr2:135042500-135042606 BLAT!
TTCTGGCCATTTGGATATTGTTGTAAATGTTTCAGGTGTTAAGCATACTTAATTTTGTGA
GTTTTGATTTTTTGTTTTGGTCTTCTTTTTGTTATTGTGTATTGATT


invisible?    
Gene introns: MGAT5 (135011829 - 135206468)  

>32064 130 194     1p22.2    chr1:91211982-91212111 BLAT!
AATTGGAATTCATTTTCTTGTGACTGGCATTCGTGTTAGTTATCTAATTGCTGTATTCGT
TCTCTCACTGCATTAGTCATCTAATTACCCCTAAAGTTCATTCCTTAAAGCCATAAACAT
TTATTATCTC


invisible?    
Gene introns: 0  

>10807 116 193     9q21.13    chr9:76112113-76111998 BLAT!
TACAATAGATTTTTCACTTTGCAAACTTTCGGTGGAAAAGAGTAAACATTCTACTGGGGA
AGAAGCTAGACATTCTTTTTATGTTTGTTTTGGGGCATTCTTGATCTGAGAACATT


invisible?    
Gene introns: 0  

>21293 116 193     Xp22.2    chrX:11169706-11169591 BLAT!
CGTGCTTGTCTGCTTAAGTATTTGGCTTCAACCAAAACGGGATGCCAGAGGGGGATTAGA
AGAGATTTTTATGACTAAGAATGCAAGACCAGGAGTCTGTGACCAGCCTGGTCACC


invisible?    
Gene introns: ARHGAP6 (11161516 - 11683821)  

>21591 108 193     Yq12    chrY:58980530-58980586 BLAT!
CACTCCACTCCATTCCATTCCACTCCTCTACACTCCATTCCACTCCACTCCACTCCATTC
CACTCCACGCCTTTGCAATCTATCCCATTCCACTCCTTTCTTTTGACA


invisible?    
Gene introns: 0  

>24352 115 193     6q27    chr6:166540529-166540415 BLAT!
AGTGGCCCGCATGCCAGCCTGGCTTTCTTGTGCTTCGCTGACTGCGCAGCCTGACTTTCT
GGGGTTCCTCAGAGCCATCACCCAGAGGCCACCGATGCTCATTCTCAGGGTTTAT


invisible?    
Gene introns: 0  

>11569 105 192     4q24    chr4:101939331-101939227 BLAT!
AACCCTGGCAAGTTTTCCTTGCAGATATAGACAAACTGATTCTAAAATCTATGTATTGTA
GAAAGATTAAAGAACTAGAATAGCCAAAATGTTTTTCAAAGTCCA


invisible?    
Gene introns: 0  

>5270 105 191     4q22.1    chr4:92515509-92515613 BLAT!
CATATATATACACATATATATACACACATATATACATATATACACATATATACACATATA
TATACATATATACATATACACACATATATACATATATATACACAC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

Shown 2821-2850 from 3142 sequences on 95 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs