Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2911-2940 from 3142 sequences on 98 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>3147 107 181     5q13.3    chr5:75321332-75321226 BLAT!
AGGGTAGTGATTTCCACTGTAATATGATGTTTAAGGTGTTAGGTAGAGCTTTTTAAAAGC
CTTATTTCCTTCTGCTACGAATAAACAGCCCAGCAGTTTGTGAAAAG


invisible?    
Gene introns: 0  

>6034 108 181     7q21.11    chr7:84526958-84526851 BLAT!
GTCACCCATCACATCTAAGCAAGAATATTTTGTCTAGAAACATGGAACAGACCACCCATT
CATAGGGTTGGCAAATGGATAAAAAAGAAAAGGTAATGAATTAAGAAA


invisible?    
Gene introns: 0  

>7707 124 181     2q12.1    chr2:103582219-103582342 BLAT!
TTGACAGAGTCAGTGACACACACTTCTCTTCGATGACACTCCAGGACAAAGTGAGCAGCC
TGTGGGCTAGGACTAGTCTGAAGAAATGAAAACAGGAGACAACTAAGCCATGGGTGGAGA
AACC


invisible?    
Gene introns: 0  

>9113 109 181     6p12.3    chr6:47090084-47090192 BLAT!
ATGGTGGATGAGGTAAAACTTTGTAGCCCAATGCATTCAATTTTTGAAGCATTGGTTGTA
TGACATGCGGTTGGGCATTGATATGGAGAAGAATTGGGCCCTGTCTGTT


invisible?    
Gene introns: 0  

>9255 102 181     1q31.1    chr1:186472937-186473038 BLAT!
ACTCACATCGTAAATTCTCTGCCTTTTAACTCACCTAAGCTTCAGTATTTGCAGGGTCTG
AGAATGGGGAAAGGGAACTAGGTAGGCAAAACTAGAAACTTT


invisible?    
Gene introns: 0  

>11883 109 181     Xq22.1    chrX:100056887-100056779 BLAT!
ATCAAAGATACCGCCATCATTATTACTAATAAGTTTGTCATCTAATATTCCACCATCATT
TCCTTCTCCAAAATTATCATCCTTATATTGATCTTCATATTCTAAATGG


invisible?    
Gene introns: 0  

>19443 118 181     7p14.2    chr7:35252823-35252706 BLAT!
CCTGAAACAACTAAGAAACATACAAAATATGCAAAACAATGTTTTTTATGACACTGGATA
TCAGGCAACAAAAGACAATAATCTCTGAGGGATGGGAAACAAATGAGGTGAGCCCTGT


invisible?    
Gene introns: TBX20 (35242041 - 35293711)  

>30586 121 181     9q21.13    chr9:78473610-78473730 BLAT!
GGCTTCCCAATGACCTCACCCTTTCATACATGAATAGGTCACTCCCAGATAACAACCACT
CTGAAACATGCCAGCCGGAAGGGAAGGGTCAATTTTAGAAAGTCAACAACCCCACTACCC
A


invisible?    
Gene introns: 0  

>31338 102 181     12p12.3    chr12:17959698-17959597 BLAT!
GAGCCTATGTGTGTCTCTGCACATGAGATGGGTTTCCAGAATACAGCACACTGATGGGTC
TTCACTCTTTATCCAATTTGCCAGTCTGTGTCTTTTAATTGG


invisible?    
Gene introns: 0  

>33174 100 181     18q12.2    chr18:35927226-35927145 BLAT!
AGCGTGGTCGCGGCCGAGGTACATAAAAGAATGGATATCTTTAGATGTATCCTTTAATAT
ACATCCCAGCATTTTCTTGGATTCCAGCTGGAACCTGTTG


invisible?    
Gene introns: 0  

>6344 110 180     Yq11.221    chrY:15344558-15344667 BLAT!
TGATTAATTCTGTTGCCCACTCTACTTAATTCTTAAAATTTCAGTTATCGTATTTTTCAG
TTCCAGAATGTTTTTTTTTCCCCATAACCATCTTTGTGTCATTCTTTTTG


invisible?    
Gene introns: 0  

>12910 107 180     1q43    chr1:238309687-238309793 BLAT!
AGGCCATGAGGTCTCACAATGTGCCCTCTGTAGATTGGAGAACCAGGAAACCTGGTGGTA
TAATTCAGTCTGAGTCTGAAAGCCTGAGAGCCATGGAAACCAATGGT


invisible?    
Gene introns: 0  

>16006 110 180     11p11.2    chr11:45332456-45332547 BLAT!
GAGCGGCCGCCCGGGCAGGTACATCTCCTGGTGAACACATGTATTTACCCAAATGGGGCA
TCATCACTGGGTTATTGGATGGGCACATGTTCGGCTTTATTAGAGACAGA


invisible?    
Gene introns: 0  

>25386 107 180     2q35    chr2:216022044-216022150 BLAT!
AAAACGTGTATGTAAAGTGTAAAAATTGAGGTCAAGGGTGCAGTTTCATGCTTAGAATAA
CCTTAGGGAGATGTGTGCCAAGTCTACAATATTATGCTTAATTGTGG


invisible?    
Gene introns: 0  

>28014 105 180     11p12    chr11:42412529-42412425 BLAT!
TGTATGTATCCTGGCAGGCTTTCAAATTTATATTTATACTGACCTTCATGCTTTTATTCT
TGCATTCATCTGTCATCTTCTTGACAATTCTCCATGAAAGTAGAG


invisible?    
Gene introns: 0  

>4072 116 179     6q16.3    chr6:101141943-101142058 BLAT!
AATTATATTTGCTCTTGGATAAAAGTTTGAAAATTCTAAAATCTCATCATCCCTTTCATT
TTCCTGAATAATATTTTTGGGAAAAAAATTGGTAAAAATTTCTATTTAAAAATAAA


invisible?    
Gene introns: ASCC3 (100956607 - 101329224)  

>6301 106 179     13q21.31    chr13:63558380-63558485 BLAT!
GTTTAAGGATTTTTATCTCAACTATGAATAAGTAAAAGTGTCCACTTCTGTAGTTGACCC
TTAAGCTGGTATTCATCTTTATCATCTCTTTCCCACACCATTCACT


invisible?    
Gene introns: 0  

>6964 116 179     4p15.1    chr4:29483996-29483881 BLAT!
TGTTATTCTTGTAAAAATAGATTTTTAGCTTAATGAAACAGAGTAAATAATTAAAGAAAA
TAACCTAATACAGGTTGACTATTACTTATCCAAAGCGCTTGGAACCAAAAGTCCTT


invisible?    
Gene introns: 0  

>7628 112 179     12q21.32    chr12:87839079-87839190 BLAT!
TGATGTATTGTCACTGAGTTCCAAGAAGAAACACAAAGTTCGATTAATGAAAGCATCCTC
CCCAGAAAAAAACACCACTATGATGAAGTAACATAAGAAATTATTTCAAGAG


invisible?    
Gene introns: 0  

>9264 117 179     4q13.1    chr4:65098092-65098196 BLAT!
AGGTACGCGGGGTAGTCCATAGTTCAGTGACATCTAAGTTCTTGTCCTGCAACCAAGAAG
AATGAGGCATGTGGATACCAGAGAGTGAGTAGGGTGGAATTTATTGAGTAAAAGGAA


invisible?    
Gene introns: 0  

>11025 127 179     6q22.32    chr6:126944683-126944557 BLAT!
AGGAAGACAACTGTATATCAGTTCTTGGCAGTAACCAACCTAGATTGAAGCAGGATACTC
AACAGATTGTATAATAAAGGTTTAAAATTAAAATATTGATGAGTCTAAGTCAAAGGCATG
TATATTT


invisible?    
Gene introns: 0  

>15469 116 179     12q13.11    chr12:49030346-49030231 BLAT!
AGTCCAATTTACATCCAGATTTGGGGATGATCAAAAAAGTCCACTGTTACCTCTGCTACT
GCTTTTTGTTTTGTTTTTTTAAATGGGCAGAAAAGTTCATGTCTTGCTGGCTACAA


invisible?    
Gene introns: 0  

>19707 107 179     3q26.33    chr3:179185078-179185184 BLAT!
GTGTGAGCCACTGTGCCTGGCAAGAATTTATACTTAGGCATAGGAGATGTTTCTGGATTA
GTTAAGAAATTCTGCTATCAGTAGGAGTAGAGGTTTAGAGTTTTACC


invisible?    
Gene introns: 0  

>22222 102 179     1p36.31    chr1:5875982-5876083 BLAT!
GCAAAAACCGCAATTACTTTTGCACCAATCTAATACAAATGATAATTAATAAACAAAAAT
CAACATTTATTAAATGCTTATTCTGCACCAGATAATGTGCTA


invisible?    
Gene introns: 0  

>22972 115 179     14q21.1    chr14:41267379-41267265 BLAT!
TGGAAAGAGGTTTTTTATATCATTGACTTTCTGTCTTCCTATGATCTTCTCTTTCCTTCC
CTTTAGAATATTTTTCTTGAAACAGTTGTTTACACTTGCAGTTTCCAATTTTATA


invisible?    
Gene introns: 0  

>24100 121 179     21q21.3    chr21:30112392-30112512 BLAT!
GATATGCGTTTTACACACCGTCTATAGAAAAAGCACTTTCCAAACACCCAGTGTATGTTT
TTCATGTAAATTCACTTTTCTGATCCTTTTAGTATATTTATAATGGAAATTCTCTCTACT
T


invisible?    
Gene introns: 0  

>24296 123 179     16q21    chr16:62192576-62192454 BLAT!
ATGCTCAAGCAAACAACCTTTACATTGCTGAGTTTCGGTTTCTGAATCTTTAAAATGAAG
ATAATAATAGAACCTGCCTCAAAAAGTAGTTATGAAGATTAAATGAGACTATTCAAATCC
AAT


invisible?    
Gene introns: 0  

>26312 113 179     22q11.21    chr22:19622677-19622565 BLAT!
CTTTCCTAATTTCTTGCCATTCATTTTCAATTTTTTAAAAGTTTTAAGTTCAGAGAAATG
TATGTATGTTGTCACGTATCTTGTATCAGTTTCTTGTTTAAAGTTTGTTTGGA


invisible?    
Gene introns: 0  

>9128 110 178     2q24.3    chr2:169268657-169268548 BLAT!
AGGCAGAAAATTCCAAAAACCAAAACGCCTCTTCTCCTCCAAAGAATCACAACTCCTTGC
CAGCAAGGGAAAAAAACAAAACTGAGAATGTTTGATAAATTGACAGAAGT


invisible?    
Gene introns: 0  

>16479 100 178     3p24.3    chr3:20880477-20880378 BLAT!
ATAAACTAAATGGTTTTTAAAATCTTTTCCAATTCTAAGATGTTGTAAGATCAGATAATT
TTTTGTAGAAATATCTGCCTCGTTAACTAACATTATATAA


invisible?    
Gene introns: 0  

Shown 2911-2940 from 3142 sequences on 98 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs