Postparser v2.3 // project Bladder

Databases: ABC1_contigs // chromosome: chr7

Shown 31-60 from 89 sequences on 2 of 3 pages.
Pages:  1  2  3

>966 210 1121    7p12.3    chr7:48943096-48943295 BLAT!
CATTAGGCTAGATGCCAGGGCTTCTGCTTCAGTGGAAGGAACCTTGTAGATTTTTCCACC
CTTATAGACAAAGCTCCCTTCAGTCACTTTAAAATCCAGATAGCGAGTTACCTCTGTATA
AAGCAGCATCTTAACCAGCTGACCATTAGCCATAAGGAACTTGGGAATCAAGTCAACATT
CCAGTCTCTTCCTCTCCCCATTGACTCGGG


invisible?    
Gene introns: 0   Nearest EST: 0

>6715 194 900    7p12.3    chr7:48943096-48943271 BLAT!
TTTTCAAACAATCCCATTAGGCTAGATGCCAGGGCTTCTGCTTCAGTGGAAGGAACCTTG
TAGATTTTTCCACCCTTATAGACAAAGCTCCCTTCAGTCACTTTAAAATCCAGATAGCGA
GTTACCTCTGTATAAAGCAGCATCTTAACCAGCTGACCATTAGCCATAAGGAACTTGGGA
ATCAAGTCAACATT


invisible?    
Gene introns: 0   Nearest EST: 0

>18449 123 251    7p12.2    chr7:49079452-49079330 BLAT!
CTGTGTTCACTCAAGGCCCTGGAGCTCTGAAATCAGCAGGTGGCAAAGCCAGCCAAGCCT
GTGTCTTTCCCTTCAGGGTGCAAGGTCCCCCGGTCTCTGGGTTGGTAGGGAGTCAGGGAC
TAG


invisible?    
Gene introns: 0   Nearest EST: 0

>15313 138 316    7p12.2    chr7:49079579-49079716 BLAT!
TTTCCCTAGCTCCAAGTGGTTCAGAACAGAGAGTGAGAGAGACTATGTATGTTTGGAAGA
AAGTAAGAGAAGAGAACAAGAGTCTCTGCTTAGAAATCCAGAGAATTCTCCCGGAATATG
TCCAAGATTATCAAGGTG


invisible?    
Gene introns: 0   Nearest EST: 0

>15632 100 122    7p12.1    chr7:52491883-52491784 BLAT!
TGTTACTTTTTACTTTCTGCTCTGTATTGATTCAGTTATTTAAAATTAGTAGGTAACATT
ATGACAAATTTAAAATGTCAATAATATAAAATTATAGCTT


invisible?    
Gene introns: 0   Nearest EST: 0

>4906 185 707    7p12.1    chr7:52508758-52508574 BLAT!
AATAGTAATGAAACATTTTAAACAGAAGGAAAATTATACCAAATAGCAGGTTATAGATGC
AGTCTGAAATGAAGAACAAATAAAACGTTAAATATGCTACAAATTGAGAGGATAAAACAG
TAAACGTAATATCTTGTGGAGTTACATAAGTATATAACTTTAACAGAACTAAGAAATAAA
TCCAT


invisible?    
Gene introns: 0   Nearest EST: 0

>20709 136 310    7p12.1    chr7:52676868-52677003 BLAT!
CTGATTTTTTCCCTCAAATGTAACAACAGTCTTTTAATTTAATCTCTATTTCCAAGATTG
GCCCTCTCTCTCCAGGCAAGGCTGCTACCTCTGCTAATGCTGCTTGTGCTACTGCTGCTG
CTGCTACTACTACCAG


invisible?    
Gene introns: 0   Nearest EST: 0

>7291 121 234    7p12.1    chr7:52947405-52947305 BLAT!
CTATCGCTCAGGCTCGGGTTCAGTGGCATGATCTCATCTCACTGCAACCTCCATCTCCTG
GGTTCAAGCTATTCTCCCATCTCAGCCTCCCGAGTAGTTGGAACTACAGTCGCACCCCAC
C


invisible?    
Gene introns: 0   Nearest EST: 0

>13167 168 440    7p11.2    chr7:56356812-56356645 BLAT!
ATTTACCAACTTAGAAAATCTGGCCAGGAAGTCAACATCTTCTTCCTGGTCAATGCTGAA
AAACCCAGCAGACTGTAATACTTGACACAAAGATTCCACTAGTTTCATTTTATCAACAGG
GTCCATTCCTTTATTTACAACTTCAAATAAACAGTCACATGCTTCTTC


invisible?    
Gene introns: 0   Nearest EST: 0

>5369 228 1606    7p11.2    chr7:56570073-56570269 BLAT!
GGTGTCACTTTCCACAGGGATGGCTGAATCTCTGTAAATGTTGACATTTTTTCGAATTGC
CTCATCTTCTTCAAGATCTTCAAGAAAATCTTGGTATTGCCTTTCATCATCTGTATCCAT
GTTTTCTCTCTCTCTTGCAAGCTCTTTCAATTTCCAGTTTCTACGACGCTGACGTTTGGT
CCGGTCATAGCTCTTCTTGATTAATACCTGCAAGATAAATATTTGTAA


invisible?    
Gene introns: 0   Nearest EST: 0

>10213 194 488    7p11.2    chr7:57875310-57875117 BLAT!
GGGTGATGTTAAAGACCTTCAGTTTTGTAAAGGAAGCAGAGCATACGGTTTTGGAAAATT
TGCAGCCTGACAATGTGATAGAGAAGAAAATCCCATTTTCTGAGGATAAATTCAAGCTCT
CTGCAGAAATTTGCATAAGTAACAAGAAGCTGAATGTTAATCCCCAAAACAATGGGGAAA
ATGTCTACAGGACA


invisible?    
Gene introns: 0   Nearest EST: 0

>8303 231 978    7q11.22    chr7:70399283-70399053 BLAT!
CAACTTCAACCTCCTGGGCTCAAGTGATCCTCCCACCTCAGCTTCCCTGGTAGCTGGGAC
CACAGGCACACACCACCACATCTGGCTAATTTTGGGTATTTTTTGTAAAGATGGGGATTC
TCCATGTTGCCCAGAATATAAAGAGCTTCAATAACTTGCTGAAGTGTAGCCTCTACAGAG
GAAGAGCCACAGTTCAACTCAGGTATTCAGCTCCTAACTCATACTTTTAAT


invisible?    
Gene introns: 0   Nearest EST: 0

>19895 113 217    7q21.11    chr7:79691415-79691337 BLAT!
GCCATCCACATAAGATGTGACTTGCTCCTCCTTGCCTTCTGCCATGATCGTGAGGCCTCC
CCGGCCATGTGGAACTGAACAATTACACCAAAAGAGCATCTTCTTCTTTCTCT


invisible?    
Gene introns: 0   Nearest EST: 0

>6508 203 619    7q21.11    chr7:81098487-81098285 BLAT!
TTCCCTACAGTCTGCAGCTTCAGGTTAAGCATTTTCTCCTCTCAAGTGCATCTCCAGACT
TGAGTCTGGGGACCCTTTTCTGCCACTCCACCTTCCTCCCTTTATGGTTCCTCCCCAAAA
TTCTTGGCCCTATGGCCACCTCTATGTTTAGCATACCCTCTCGAGGAACTCAACTAGAAT
AGTGACTTGTGTGCCTGTATTCA


invisible?    
Gene introns: 0   Nearest EST: 0

>6825 109 170    7q21.11    chr7:85555831-85555723 BLAT!
TTAACTCTGTTTTCTGTTTTTTCATAAGGTTTGACTTGACTGACCCAGTTGACATGTGGG
TGATCCTGTTCTCCCTCAAAGCACCATGTGTGTCCTTCTAAGCTATTCA


invisible?    
Gene introns: 0   Nearest EST: 0

>11562 105 178    7q21.11    chr7:86148678-86148782 BLAT!
CCTGGGAGAAAGAGGACTAAGGAAAAAAATGTTTGACTCTTTGCTTGTTCCCTTTCTGTC
ACAAATTTACATTTGAATTATCCATCCTATCATCCAATTGACTAG


invisible?    
Gene introns: 0   Nearest EST: 0

>13472 144 342    7q21.12    chr7:86734077-86734220 BLAT!
CTTTTGAAATTCTTCATGGGTCTGCAGCCATAGGTCCTGCTAAATTTTACACTTGATAAG
CTAACCAATTCTTGATTTTATTTCAAAATTCAGAGGAATAAGGAAACTGCTTCTTTCTTT
TCCAGGAAATTCATTTAAAAATTT


invisible?    
Gene introns: 0   Nearest EST: AA062546 (86734171 - 86734478)

>15136 305 1424    7q21.12    chr7:88051984-88052288 BLAT!
TTGCTTATTCCATCTTAATCTTTTCATTTATAATTTCTATTTCTGTGTCTGCTTATAGTG
TGTATAATATGAGCACAATAATAAATATATGTAATATATTAGTGGGGCAAGGTTTCTTTT
TCTGATGGGGTGAATTAATTTTTTTTTAATTTGAAGAAGGTGAAAAGCTAAATCTCTATT
TCTAAGCCCACCTTGTCTGAAAATTGAAAGGTGGAAGTGAGGGATAGGTCTCTTCCCTGT
AGTTAAAGTCAGGCTGTTTCTGAACTGAAACTGCAAAAACTCCATGCACAGCTTGAAAAG
AGATT


invisible?    
Gene introns: 0   Nearest EST: 0

>18925 139 263    7q21.12    chr7:88078723-88078861 BLAT!
TAATGGCCTGCATTTGCATATCAAAGTTTGCCTACCTGGCTCTCAACATATCTCCCCACA
TATCTCCACATGTGTAGAACATCCAGGGCACCCTGCATTTGCATATTAAAAGGCTACAGT
GGGAGAGCCAGCTTTTTTG


invisible?    
Gene introns: 0   Nearest EST: 0

>372 125 6974    7q21.12    chr7:88194392-88194516 BLAT!
TCTGTTCAACTGTTCCACCACTGGTATAGTTGGTCACGGCCCACACAGCTTCCTTTTGTG
TCTTAAAATCTGCCTTAGAGAGAACACTGACAAGGAATGGGACTAATCCATGATTCACAA
CTTGC


invisible?    
Gene introns: 0   Nearest EST: 0

>15193 134 225    7q21.3    chr7:94433685-94433552 BLAT!
CAGATCTCCTTTCTGTCAAAATAATTCTCTTCAAGAATTTGGTAAAACTGTAATCATACA
GTATATATTCCCTTGTATCTGGCTTCTGTGGTTTAACACAATATTTTTGCAATTTATTCA
TGTATCAGAATTAT


invisible?    
Gene introns: 0   Nearest EST: 0

>5225 145 526    7q21.3    chr7:94434665-94434809 BLAT!
TAAAGTCAATGGGCAGAAAAAAAAATTACCTTTCCTATGAAGGCATACAAGAGACTGCAA
AGTTACATGGAAGTGTTGTGTTATGGACTGAACATTTGTGTTTCCCCTAAATGTATAAGT
CAAAGCCCTAACTCCCAATATGATG


invisible?    
Gene introns: 0   Nearest EST: 0

>10571 160 273    7q21.3    chr7:97270947-97271106 BLAT!
GGCTCATTACAGAGAAAGATGCCAACTTCTCTAGCTCAAGAACATTCCAAGCAAAGTAGC
TAAGAAAAAAACAAAAAACAAAAACTGTCTTCAGAGAACACTACTGAATTTTGTGGTAAG
CACATTAGCTGTTCTAAGAATTTGCTTTTCCTGTCCGCAT


invisible?    
Gene introns: 0   Nearest EST: 0

>6405 180 743    7q22.1    chr7:98343420-98343241 BLAT!
TTCCTTAAACTGCCACACAAAACTGTGCTTGGATTTGGTATTCAAATGATATCTTTGTAG
TGAAAATGATCACTAACGTAATATGTAACTCTAACATGAAACCTGATTTTATTGCGTTAC
AGTTCTGATTTTATTAGAACTGGATCATTTTGCCAAAACGGTATACTTTGGTGAAAGGGT


invisible?    
Gene introns: 0   Nearest EST: 0

>6544 125 196    7q22.1    chr7:98343832-98343952 BLAT!
CTTGAGCCCAGGAGTTCAAGACCAGCCTGGGCAACATAGCAAGACCCCATCTCCATAAAA
AAATTAAAAAATTAGCTGGGCATGGTGGTGTGTGCCCGTGATCCCAGCTACCCTGGAGGC
TGGGG


invisible?    
Gene introns: 0   Nearest EST: 0

>12201 200 1464    7q22.3    chr7:105170800-105170931 BLAT!
CCACCTGCCTCCACCAGCTGCCAAGACTGTGGTTGAGAACCTCCCCAGGACAGTCATCAG
AGGCTCTCAGGCTGAGCTCAAGTGCCCCGTGTGTCTTTTGGAATTTGAGGAGGAGGAGAC
TGCCATTGAGATGCCTTGCCATCACCTTTTCCATTCCAGCTGCATTCTGCCCTGGCTAAG
CAAGACAAATTCCTGTCCCT


invisible?    
Gene introns: 0   Nearest EST: AA782412 (105170481 - 105170923)

>22999 201 904    7q22.3    chr7:105245329-105245128 BLAT!
CACCTTATATTTTGTTATGCTGTCGGCCCATGGCACTTTAACAAAACTCTGTGGGTTTAC
GTAGCTGGTCAGTCATGGGGTATATTAAATAACTGTTGTTGCACAGACAAGAATTTGCAC
CTGCTCATTTGTCCTTTCCTACTACCAATTTTAGAACCTTTTCCAGAAAAATTTTGAAGA
AAGCATGTCCGATCATTCTAA


invisible?    
Gene introns: ATXN7L1 (105245220 - 105517031)   Nearest EST:

>20016 199 1074    7q22.3    chr7:105766208-105766406 BLAT!
AACTGTGAAGCAGTGGAAAATGGATGGGCCAGGCTATGGAGACGAGGAAGAGCCATTACA
TACAATATTAGGAAAGACAGTGTATACTGGGATTGATCATCACTGGAAAGAAGCTGTTTT
TGCCACATGTGGACAGCAAGTAGACATTTGGGATGAACAAAGAACTAATCCTATATGTTC
AATGACCTGGGGATTTGAC


invisible?    
Gene introns: 0   Nearest EST: 0

>20588 467 12854    7q31.1    chr7:108634908-108634461 BLAT!
GAGCGGCCGCCCGGGCAGGTACCAGCACACCGGCGCCGTCCTGGACTGCGCCTTCTACGA
TCCAACGCATGCCTGGAGTGGAGGACTAGATCATCAATTGAAAATGCATGATTTGAACAC
TGATCAAGAAAATCTTGTTGGGACCCATGATGCCCCTATCAGATGTGTTGAATACTGTCC
AGAAGTGAATGTGATGGTCACTGGAAGTTGGGATCAGACAGTTAAACTGTGGGATCCCAG
AACTCCTTGTAATGCTGGGACCTTCTCTCAGCCTGAAAAGGTATATACCCTCTCAGTGTC
TGGAGACCGGCTGATTGTGGGAACAGCAGGCCGCAGAGTGTTGGTGTGGGACTTACGGAA
CATGGGTTACGTGCAGCAGCGCAGGGAGTCCAGCCTGAAATACCAGACTCGCTGCATACG
AGCGTTTCCAAACAAGCAGGGTTATGTATTAAGCTCTATTGAAGGCC


invisible?    
Gene introns: 0   Nearest EST: EH345952 (108634792 - 108634820)

>3302 124 270    7q31.1    chr7:112637489-112637366 BLAT!
ATAATGTATCTGATTTATAGAACATTCAGTTTCAAATGCATTGTAAATTAAATAAAGTTG
GCAGGCTAGCTGGAGACCATAACCACCACTTACGGAGTGTCTCATGTGGGAAAATGTGTT
CTTA


invisible?    
Gene introns: 0   Nearest EST: 0

Shown 31-60 from 89 sequences on 2 of 3 pages.
Pages:  1  2  3

Databases: ABC1_contigs // chromosome: chr7