Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 301-330 from 1945 sequences on 11 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>17519 217 1559     7q32.1    chr7:128302486-128302702 BLAT!
GCTTCCATGTGGTGTTGAGCCTGCAGGTGCACAGAAGTCAAGAATTGAGGTTTTGGAACC
TCCACCTAGATTTCAGAAGATGTATGGAAATGCCTGGATGCCCAGGCAGAAATTTGCTGC
AAGGGTGGGGCTCTCATGGAGAACCTCTGCTAGGGCAGTGCAGAAGGGAAATGTGGGGTC
GGATCCCCCACACAGAGTCCCTACTGGGGCACTGTCC


invisible?    
Gene introns: 0  

>25108 378 1556 193383+,203886-,113740+     7q31.33    chr7:125178428-125178675 BLAT!
TTCCGATCTATAGCGTGGTCGCGGCCGAGGTACATAAAAATATTTTGAAGAAAGTAAAAT
GCTTGACTTTTTCTAAGAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGTAACCCCAGAGTCTATTCTCAAAGATGTTAAACATAAATCGATGGAAG
TGTATTATTTGCAAATCTTAATTGTTACACATTTAGTGAATTTTATTTGTAACTGTTGAA
AATATAACTATTTGAAAAAACTAAAACAAACAAACAAAAAAACTTCATTCCTGGTCTGGT
ATAAAAATAATATACTTCTTACAGAATGTGTGGTTGTTTCCAGGTAAGTTAAGGAAATGC
TTTATATGAGGTCTACTT


invisible?    
Gene introns: 0  

>2274 259 1554 48279+,80045-,20137+     18p11.22    chr18:9093006-9093152 BLAT!
AAAGAACTTGGGAAGGTTTTCTTTTAAGACATTTCACATTCCCACCAACAGTGTAAAAGT
GTTCCTATTTCTCAACATCCTCTCCAGCACCTGTTGTTTCCTGACTTTTTAATnAGATGA
AATGCTGGTTAGAACAGGAAGTTCACTAGTTCAACCATTGTGGAAGACAGTGTGGCGATT
CCTCAAGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATA
CCCAAAGGATTATAAATCA


invisible?    
Gene introns: 0  

>17042 143 1552     14q32.2    chr14:100431304-100431446 BLAT!
GAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCCAAACTGTCACAG
AATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAGCTGCACACACATGTGAACGAT
GGCACTGAATTTGGAGGTTCTAT


invisible?    
Gene introns: 0  

>7998 198 1550     20q12    chr20:37957998-37957831 BLAT!
TTTTGCAAACCAGAACTTATGACCTTTACATCACTTATGATAAATATTACCAGACTCCAC
GATTATGGTTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAGCACATGTATG
AAGACATCAGTCAGGATCATGTGAAGAAAACAGTGACCATTGAAAATCACCCTCATCTGC
CACCACCTCCCATGTGTT


invisible?    
Gene introns: 0  

>23626 356 1544 34808+,201898+,85136-,120154-     Xp11.21    chrX:55817118-55817462 BLAT!
CGCCCGGGCAGGTACTTTGGCTGTGTGTAATGAAAAGGGTTGGGATGAGTTAGGGAAAGC
TAGTGTGGGAGCAGCTTTTAGGGCTGTTTTTTAAGGAATGGAAAGGGGAGTGGGGAAAGG
ATTTAGGATTTATGGGGTCAGCTAGGTTTATCTAGAACAGAATAATGGGTTGTGGAGGAA
GGTATTGAGGATAGGAGAGTATATGGGTTTGGCACCACTGGGTGGGTAGGCAAAACAATT
TGGTTGATAAGGTGCAGATCCTGAACTAACTTGTAAGACTTGTCTGGTTTTTGGACAGGT
AAAATGGGGAATTTTAAGGAGAGTTTATAGGCTTTAAAAGGCCATGCTGTAACAGG


invisible?    
Gene introns: 0  

>24863 353 1544 165870+,202289+,191329+     11q14.1    chr11:77373614-77373965 BLAT!
ATTTTGAAAACAAATTAAGTGAACATATAGCAACTCAGTTTAAATACATTGATAGCAAAA
GGCTTTGACCTTAAGGATTGGTATAAAAATGACACAAAAAAATCAGTTAACTTGCCACTT
CCAAGGTAGGTTTACAGGCACACACTTTGGGAAAGGTAGATGATATAGGAATGGATTTTA
ATCTGAGAAGATTCAATAATGGATCATATTAAGCAGAAGAGGGCTAGGTAGATTACAGCA
GATATGCAGCCTTGGCATTCTCTGCTTCTTCGAGAATGAGGAATATATTTTGAGAATGTC
AAACATCAGGAGAAACTGTTGTCTAGATTTTCTGTAATTAAATGATGTTCATA


invisible?    
Gene introns: 0  

>9522 195 1540     12p11.1    chr12:33850262-33850458 BLAT!
GTCACGACCCTCATTCCTTCGGCCTCCAACATCTCCCCTTTTGTTTTTGCATTAATTGAA
TAAAGGTAATTTCAGGCTGTGCAGCTTTCAATTGCCGGTTGGTGGTTCACCCGATCCTAT
AGACGCACAGGACACTACAGCTAGCATGGCCAAGAACATGGAGTCAGGGGTTTTTGCCTG
ACCCTGGCGCTCCAG


invisible?    
Gene introns: 0  

>19923 162 1539     Xq26.2    chrX:131264909-131264753 BLAT!
CAGTAGTTTGAGTCATACCCTCTTTGCCGAAAGTGGAAACAAAGTCCAACATATTACTGA
TGCCACACTTGCCATTGTGAAAGGAGAGACAGTTCCACTTGATGTCTTGCAGATCAAGGG
TGAAAAGGAACAGCCTGTATTTGCAATGACCGGCCTTCGATG


invisible?    
Gene introns: 0  

>3955 209 1537     18q21.1    chr18:47022262-47022464 BLAT!
TCATGGCTATACATGGTAACTAATGCAGATACCATGCCTGGTTTATGCTTTAACTCCTCT
ATGCTTCTCAATATTAGACATGCTTTAGAAATATTACCTTGAGAAATTTTCAACTGTGCC
ATGGTCAGCTTAATTTCAGCTGCATTTTCTGGATGCTGATCTGAAAATTCCTGAAGCAGC
TCTATTGCTTTTGTGTGCTGCTTTTCACG


invisible?    
Gene introns: 0  

>8457 218 1535     3p26.1    chr3:5889147-5889364 BLAT!
AAACTATGATTTTATTGTAGACCACCAAGAGTCAAACCCCTGTGGTCAATTAGCTGTAAT
TGCTTTTAAAAATGAAGAGGGATTGATTAATATCAGTTTCTTTGTCTGGCATATATACAC
AATGCTCAGTTTTTAAAAGGGCACAGATTCCTCCCTGCTCAGCTGTCAGCATTTCTAGAG
CTATTCAGTTCTGTAGGACACTTTCCTCATTGTGGCTG


invisible?    
Gene introns: 0  

>24078 294 1534 81968+,203563+,115820-     6q13    chr6:72295209-72295382 BLAT!
CGCCCGGGCAGGTACGCGGGGGGATGCTGAAGCCTGGTTCACCAGCCGGACTGAAGAATT
GAACCGGGAGGTCGCTGGCCACACGGAGCAGCTCCAGATGAGCAGGTCCGAGGTTACTGA
CCTGCGGCGCACCCTTCAGGGTCTTGAGATTGAGCTGCAGTCACAGCTGAGCATGAAAGC
TGCCTTGGAAGACACACTGGCnCAGCGGTATTGAAGCCCAGCTGGGCGATGTGCGAGCTG
ATAGTGAGCGGCAGAATCAGGAGTACCTCGGCCGACCTCGGCCGCGACCACGCT


invisible?    
Gene introns: 0  

>1184 191 1533     4q21.1    chr4:77266464-77266632 BLAT!
CGCGGCCGAGGTACGCGGGGCGCACCAAAGCCCTCATTGACTATGAGAACTCAAACAAAG
CTCTGGATAAGGCCCGGTTAAAGAGCAAAGACGTCAAGTTGGCTGAGGCACACCAGCAGG
AGTGCTGCCAGAAATTTGAACAACTTTCCGAATCTGCAAAAGAAGAACTGATAAATTTCA
AACGGAAGAGA


invisible?    
Gene introns: CCDC158 (77234191 - 77328458)  

>13681 223 1524     4q12    chr4:58969627-58969408 BLAT!
TTGATTACATTCATGCAGCTTCCTCTTGATTTAAACACTCATGACACATTGAATGAAATC
ATCATATGGGAAATTCACAACACCTTGCTGAGCAGTATCCCGTCTTCGAAAGCTGTCTGT
AAGAGCCCTCAGTTTGACGCAGCAGGCGATGTAGTCGTCGAAGGTGATCTTTCCATTGGT
GCTGTATCGTTTTGCAATTGAATTCACAGCCTGGGGACTCAAC


invisible?    
Gene introns: 0  

>1802 270 1515 1543+,79571+,73276-     1q31.2    chr1:192216625-192216421 BLAT!
ACAGAAAACTTGAGATTCAGAGATGCATCACTTGTTTTTAAAGTGGCTGAGACAGCAAAT
GAAGAAGAAGTTAAAAAGATGTGTATGTATAAATATCCAGGAATGAAGAAAAAAATGGGA
GAATTTGAGCTAGCAATTGTAGCTGGAGAGTTTACAGATTCTGAAATTATGGTGATGCTG
GGGGAAAATGGAACGGGTAAAACGACATTTATCAGAATGCTTGCTGGAAGACTTAAACCT
GATGAAGGAGGAGAAGTACCTGCCCGGGCG


invisible?    
Gene introns: 0  

>10584 203 1510     17q24.3    chr17:69647175-69646973 BLAT!
TAGGACATCAATTTTCTTTGGAAAAAGTTTTCAGGTTAACCTTCTTATTCATTGTCTGTG
ACTGAGTCACAGATAAATGAGGCTAAAACACTGATCCTCTGTGAAGTTAAGTGTCCAGTG
TGAAGTTAGCCTGAGTTACCATGCTCTTGCAGGTAACCCTTTCATGCATAGAACTTGTGT
GTAGAAACAACTAATACTCTGTT


invisible?    
Gene introns: 0  

>20813 163 1498     20p11.21    chr20:24912781-24912618 BLAT!
CTAAATACACATGGCCAAAAGGCACAATTTTCACAAACCCCTGACTCATGACAAACATAT
TTATTTTCTACTCTGTAGCTCCTTTCCCAGTTAAGAGAACCACATCCTGTTCCTAGCTTG
TTACTATTAATGGCTGCACAAGCGTCAAATCTTAAAGTTACTT


invisible?    
Gene introns: 0  

>13673 224 1497     5q13.2    chr5:72226845-72226657 BLAT!
CCGCCGCAACTACCCGTAAACAGTGAGGCCAGCCTTTCGCTACTACATCAGTTTCCTTAC
TTAGGTATGCCACTGGTGTGGGGTTTTCCCACGAGTCTGGGTAAGGACTCCAAGAGCTAT
CTCTGCTCTCTCTGTGACGTATAAAGATAAGTTTTGTCCTGTGGGAAGGCTTAAGGCTGG
AGCTTGTACAGAGAGCAGACACTAGCTTAAACAACTGTGAAGGT


invisible?    
Gene introns: 0  

>7973 203 1487     1p13.2    chr1:116008732-116008934 BLAT!
TTCACCCGTGCTCTGGATGTAATCAGGATGTAACGCGGGGGAAGCCAGTCAGGAGCAAAG
CCAAGGTTAATACCAAGGATGGAGCTTCAAGGAGTTAGAAGGCAGGGTCCGGGCTGGGGG
GCTGGAAACCTAGGTTCAGTGCCTTCCCAGCCCTCACTATCCCTAGGCAGTGCTGTTCCT
CATGAGCCTCTGCCCCTGTGGCA


invisible?    
Gene introns: 0  

>1926 327 1479 14625+,79599+,46941+     21q21.1    chr21:21132127-21132009 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGATGTCTGGAGGTTGGGAGCTGGAACTGAATG
GGACAGAAGCGAAATTAGTGCGGAAAGTTGCCGGGGAAAAAATCACGGTCACTTTCAACA
TTAACAACAGCATCCCACCAACATTTGATGGTGAGGAGGAACCCTCGCAAGGGCAGAAGG
TTGAAGAACAGGAGCCTGAACTGACATCAACTCCCAATTTCGTGGTTGAAGTTATAAAGA
ATGATGATGGCAAGAAGGCCCTTGTGTTGGACTGTCATTATCCAGAGGATGAGGTTGGAC
AAGAAGACGAGGCTGAGAGTGACATCT


invisible?    
Gene introns: 0  

>5169 174 1477     10p12.2    chr10:23930778-23930951 BLAT!
TGATGATGAAGATGATGATAACACTGAAGCAAAAGTGCCTATAGATGACATGGTGAAAAT
GTATAATGGGCTTGTTGAAGGACTAGAGCAGCATGTATTCATAACAGGACAAGAAATGAC
ACCAGTTTATAAAATCAAAGAGCAATTTCCAGGACAAAAACCCTTGTCAAGGAG


invisible?    
Gene introns: 0  

>6492 277 1474     Xq13.3    chrX:75250297-75250021 BLAT!
TTAATTTTTCTTCTTATAGAAAAAGTTTAAATCAGTTTATTATAAATATATCTAAACCAT
TAATTTTTGCAGCTTTCAGGTAAAGTCCAGCACTTCATTTATACAAAATCTATGAGAAGA
GGTCAGTAGAGATCATCTAATCTTAAGTCGTGACATCATCCATTCAAGTCCTTGGCACAA
TCCCTCGCCAGTTAGAGCACAGCATGCCTGGATATGCCACTGGTGATCTTTAATAGAAGT
TAGCTTCAAAAACTGGGAGATTTCTGCTACAGTCATG


invisible?    
Gene introns: 0  

>7724 176 1466     4q21.1    chr4:77266637-77266462 BLAT!
GCCACTCTCTTCCGTTTGAAATTTATCAGTTCTTCTTTTGCAGATTCGGAAAGTTGTTCA
AATTTCTGGCAGCACTCCTGCTGGTGTGCCTCAGCCAACTTGACGTCTTTGCTCTTTAAC
CGGGCCTTATCCAGAGCTTTGTTTGAGTTCTCATAGTCAATGAGGGCTTTGGTGCG


invisible?    
Gene introns: CCDC158 (77234191 - 77328458)  

>12201 200 1464     7q22.3    chr7:105170800-105170931 BLAT!
CCACCTGCCTCCACCAGCTGCCAAGACTGTGGTTGAGAACCTCCCCAGGACAGTCATCAG
AGGCTCTCAGGCTGAGCTCAAGTGCCCCGTGTGTCTTTTGGAATTTGAGGAGGAGGAGAC
TGCCATTGAGATGCCTTGCCATCACCTTTTCCATTCCAGCTGCATTCTGCCCTGGCTAAG
CAAGACAAATTCCTGTCCCT


invisible?    
Gene introns: 0  

>7648 191 1454     17q22    chr17:52381352-52381162 BLAT!
GAAATAGGGAATACTGTGGTCTGATTGTGTAGAGCACGGGTTTTAAAGAGAACCCACATG
AACTGAATGAAAGGAAGAAAAGAGCCACTTGTTCCTCATCACCTTTGACCAGTAATTTCC
AAGTTCCCACTCTAATGCTTTGTCATCAATGCATAACAGAGATTAAAAGCCAATTAATGT
CTGTTCTGAAT


invisible?    
Gene introns: 0  

>10850 239 1452     4q21.22    chr4:84009040-84009278 BLAT!
AGAGGGGATCTTCATCAATCATATACAGAATATCTACAAAAAACCTACATCATACTTAAT
GATGAGAGACTATATGATTTTCCCCTAGGTCAGGAACAAGGCAAAGATGTTTACTCTCAT
GTTCCTATTTAATATCATACCAGAATCCTAGCTAATAAGACCAGATAAGGAAATGTAGCT
TTATACAGATTGGGAAGGAGGAATAAAACTGTCTTTGTTCACAGTCAACATGATTGTCT


invisible?    
Gene introns: 0  

>8957 288 1451     8q11.23    chr8:55435469-55435753 BLAT!
TCTTTTTTCTCTAGCCAATGTTGTCCTTGTTTATAGAGGCCTCGGTCATCAACCGCATTA
TTATCTCCTTTGGTCAAAAACTTGATATGCCCATTTTGCTTTTCATGAATCTTCAAGACT
CGGTGAACTATAGGAATCTCTCTTCCTTCTATCCTAAAAACAACAATTTCTCCCACTCGT
ATGGGATCTTCAACTCGATTTGTTAGAAAGAGAAGATCTCCTCTATGAAATGCAGGTTCC
ATGCTGCCACTGAGCACCACTACAATCGGACTTTCACTTCCAGTTATT


invisible?    
Gene introns: 0  

>2370 231 1446 57320+,79679-,29+     19q13.2    chr19:39708110-39707970 BLAT!
CGGCCTCCTCCATCTTCAAATAACATCTCTCCAACCTCTGCTTCCATCCTCACCTTGCCT
CCTCCTCTGTAGCCAAATCTTCCTCTGCCTCCCTCTTCTAGGGAGCCTAGTGATTCCATT
TAGGGTCCACCCAGATCTTCCANNNNNGATATCTTGAAAGCCATTATCAGTGACCACACC
CCCCTTCTTCCTACTGTACCTCGGCCGCGACCACGCTATAGATCGGAAGAG


invisible?    
Gene introns: 0  

>22186 160 1446     Xp11.3    chrX:43889885-43890041 BLAT!
AGAAGAAGAAGTTGGATGGGATACCGAGATTAAGGATGATGTGATTGAAGAATGTAATAA
ACATGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAATGTGTATGT
GAAGTGCCCATCAATTGCTGCAGCTATTGCTGCTGTCAAT


invisible?    
Gene introns: 0  

>23668 305 1445 38463+,202971+,179456-     8q11.21    chr8:50319355-50319571 BLAT!
CGTTTGGGATTGTGGATTGTGTCTTTCAGGATTATAATTAACTCTCTGTAAGGACATATT
CCATTTTGTCTATGCATTTCTCAATTGATGGACATTTGAGTCGTTTCCACATTTTGACCT
TTTTTCAAGGGTATATACCTAGAAGTGGTTACTGGGTCATACAGTAACTATATGTTTATC
ATTTTGGGAAACTATCAAATCACTTTCCAAAGTTGGTnTGCTTCTAATTTATCCACATCC
TAGCCAAAATTCATTATTGCCTATCCTCAAAATTGTAGTCATGCTAGTGGGTACCTGCCC
GGGCG


invisible?    
Gene introns: 0  

Shown 301-330 from 1945 sequences on 11 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs