Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1561-1590 from 1945 sequences on 53 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>11083 126 233     4q12    chr4:59499746-59499871 BLAT!
GCAGCATTATACAGAACAACACACACAAGATACATAAATTGAACAAACAATATTTCACCA
AAAAACAGGCACAAAGCATGATATATTGTATAACAGACAATATATTTTGGAAGGAAAGAG
CAATAA


invisible?    
Gene introns: 0  

>12716 147 233     13q31.1    chr13:79538986-79538840 BLAT!
CAGGCTGTTACACTTGCTCTTGTCTGCCCAGAATTCCACACACCTTCTCCATCTTACGCA
GGTCAAGCTCAAATGTCACCTGTTTGTCTCTGTAAAAAATGGAATCCCTCCTTCATTATT
ATCTTTGCCTTTATTCTGCTTTTTTTT


invisible?    
Gene introns: 0  

>16345 110 233     10q24.2    chr10:100121907-100122016 BLAT!
CAGGCATGCGCCACCGTGCCCAGCTAATTGTTGTATTTTCTATAGAGATGGGGTTTCACC
ATGTTTCCCAGGCTGGTCCCAAACTCCTAGGCTCAAGTGTTCTGTCTGCC


invisible?    
Gene introns: 0  

>16407 106 233     14q21.2    chr14:46111763-46111868 BLAT!
TTTGTCTCCTGAATGAATATAGTGCTTCTCGCCCCTATTTAGCCAAGATCATGTCAAATC
CAATACTTAGAAATGCCACCTAAGGCTGGGCACAGTGGCTCACGCC


invisible?    
Gene introns: 0  

>2721 145 232     1q31.1    chr1:189958841-189958719 BLAT!
AAGATGAAGCAGATCTTGCAAAATCAGCTTTGGCCATGGCGGATTCAGACCACCTGACGA
TCTACAATGCATATCTAGGATGGAAGAAAGCACGACAAGAAGGAGGTTATCGTTCTGAAA
TCACATACTGCCGGAGGAACTTTCT


invisible?    
Gene introns: 0  

>13671 130 231     16q22.2    chr16:72038345-72038473 BLAT!
TCAGCACTTCCTTTGGGATGTCTTCTATATTCTCTCCCTTATGTAATCGAAGGTATACAT
GAGCCGAAGAGAGTTTGTCCACATGAAACCAGATATCTTCAGGCCAGCCATGCTTGATCA
GATCTTCATT


invisible?    
Gene introns: 0  

>14268 109 231     Xp22.33    chrX:3980651-3980543 BLAT!
CAAGATCAAGGCCACCTGGGCATAGTGGCACATGCCTGTAATCCCAACAACTTGGAAGGC
TGAGGTGGGAGAATCACTTGAGTCCAGGAGTTTGAGGCCAGCCTGGATA


invisible?    
Gene introns: 0  

>16630 153 231     18q21.31    chr18:54047438-54047286 BLAT!
CCAGTCCATATGAAAACTGAGCAAGAGCCATTCCTTACTTTTAACAGACTGTGCTAATGT
CAACTGTGGTTTTGCACGTTTCCAAAAGTTAAATTTCAGCTTTGTAAGTGAGGCTTACTG
GTGGTGATAAACCAGTGCTCCTCTGAGCATGAG


invisible?    
Gene introns: 0  

>18922 104 231     1q25.3    chr1:184161454-184161557 BLAT!
CTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATTGCTTGAGCCTAGGAGTTTAA
GACCAGACTGGGAAACATAGTGAGACCCCATCTCTACAAAAAAT


invisible?    
Gene introns: 0  

>20046 135 231     13q31.1    chr13:81816827-81816693 BLAT!
CCTATCTACCACAAAAAGGAGTTTCTATGCACAGGCAGTAATAAATCACCACATTTTAAC
AGCAGTTGAATAATGAGTTTGTGCAAGACAACTTTGGTAGCATGGGAGGAAACAATTGCT
TCAACCAAAGGAAAA


invisible?    
Gene introns: 0  

>21516 119 231     6q22.1    chr6:115584985-115585103 BLAT!
AAGAACTAGTGAACTGGAATACAAATTGCCCATTCTAAATAATGTCCTGGAAACAGTTAT
TTCTCTAAGGACCGCATTTTATTTTACTGGAGAATGGTGTTAGAACACAAGATCTATGT


invisible?    
Gene introns: 0  

>5476 134 230     21q21.3    chr21:29814549-29814682 BLAT!
GAGAAGAGACTATTACATTGTGGCCGACTAAATTCACCACATCCCACGTGGTTGTATACA
CACAACCTTAGGAGAATTGCAAGAAGCAAGTTTGTCAAAGTGAAACCAAAGAGTTTGAAA
AGTGTCCTGTAGCC


invisible?    
Gene introns: 0  

>5595 127 230     1q23.3    chr1:162011751-162011625 BLAT!
ATGGAGGTTCTGTTACTAGGGCATGATTAATTGAATCACTGGCCATTAGTGATTGACTTA
ATATTTCTAGCCCTGTTTCTCATCCTCCCCACCTTCCACTGCCACACACAACCCCCAGGT
TGAGCGG


invisible?    
Gene introns: 0  

>11251 123 230     14q21.2    chr14:45881869-45881991 BLAT!
AGATTAATCACTAACTAGAATAAACAGTGTAGAGAAGACCTTAAATGATCTGATGGAGCT
GAAAACCGTGGCACAAGAACTTCATGATGCATGCACAAGCTTCAATAGCCGATTCAATCA
AGC


invisible?    
Gene introns: 0  

>13031 100 230     3q11.2    chr3:94958167-94958266 BLAT!
ATTCTTCACCTGGAAAACCTGTAGATTTCAATAACTACTTGGAATTACATTTCTTGACTT
GCTTATTTAGGACACATTGTTCACTTGGATTCCACATAAA


invisible?    
Gene introns: 0  

>17504 130 230     Xp21.2    chrX:30756010-30755881 BLAT!
GTAAAAAAACTGAATTTTCCTTTCTCCAATCCCCTCACCCAAGGGGCTACAATTAGCTCT
GCTAAAGCAACATTTAGAAACAAAATTCATTATTTCTTAACCTAGAAACCTGAGAGGAGA
AGAAGGAATA


invisible?    
Gene introns: 0  

>20677 139 230     4q35.1    chr4:185676445-185676307 BLAT!
ACTGGTGATTCCGTGGTGAATGTAATCCCACTATTGTATTTTAGCACTGTTTAGTCATTC
TCTTACTGTAGAATTATTTCAGATGTCTCTTTATAGCAGCCAACTTTTTCTTGTTTCTTT
TCTTCTATCTCCACCCTAT


invisible?    
Gene introns: 0  

>17289 109 229     16q22.3    chr16:73506556-73506448 BLAT!
GTGATGCAGTCTGGAGAGGCCAGTCTCATGGCACAGACGGTAGGACGGAGAAGGAGGGAA
AATGAAGGGTGAGTCTGGAGTGGTAAATAGGATAATACCCTCCTGACTC


invisible?    
Gene introns: 0  

>24695 163 229 146573+,204136+,183763-     6p11.2    chr6:57722398-57722299 BLAT!
GATCAAGGTGCCAGTGATTCTGTATCTGGGGAGAGACCACTTCCTGATGCATAAATGGCT
GTCTTCTCATTACATCCTCACAAGGCAGAAGGGCAAGGGGnCAATATAACCTAATCACTT
CCCAAAGGACCACCCCCGCGTACCTCGGCCGACCTCGGCCGCG


invisible?    
Gene introns: 0  

>11758 122 228     Xq21.1    chrX:83264654-83264533 BLAT!
ACAGCAAACATTGCAGAACAGCAAATATTGCTGCCTGATCCTTCCTCTGGGAGCTTCTTC
CCAGAGGGGCACCTGACTATATTAGGTGTCTGTAGACCCCTACTGGGACGTTTCTCCCAG
TT


invisible?    
Gene introns: 0  

>5051 132 227     10q23.2    chr10:89221584-89221715 BLAT!
TTCTGCTTTTAGCTCTTTGAGGAATCGCCACACTGCTTTCCACAATGGTTGAACTAATTT
GCACTCCTACCAACAGCATATAAATGTTCTCATTTCTCTGTAACCTCACCACCAGCATCT
GGTTTTCTTTTT


invisible?    
Gene introns: 0  

>6133 131 227     14q21.1    chr14:40922048-40922178 BLAT!
CATTCTCAGATACTACACATGTCAGCAATATTTGATGCATACAGTTATTCCTCACTGGAA
ACACTTTTCTCACTGGGATGCTAAAACATGTGATCTTTGTTTTCCTTCTTTATCACTAGA
CTCCTCTCATT


invisible?    
Gene introns: 0  

>9063 120 227     18q22.2    chr18:68692198-68692079 BLAT!
TCTTGTAGCCTCCAGCTACCTGACTCCTAAAACATAAATTCTGATCCTGTGTTAGTCTAG
TCCGCAGGCAAAAAGGAGGTCTGCTTTGGGAAAGGGCTGTTACCGTCTTTGTTTAAAGTA


invisible?    
Gene introns: 0  

>17182 103 227     5q23.1    chr5:116690597-116690699 BLAT!
TTCATTTACTTTCCAATGCTCAATTATTTTCAGCCTTACCCAAAACAGGGATTCATCACC
TCTAGAGAAACGCCAAAAGATGTCAAGATGTAGATTTGTCTTT


invisible?    
Gene introns: 0  

>18410 128 227     16q12.2    chr16:56054671-56054544 BLAT!
TTTCATAAAAGTGAAAAACTGCAAGAAAAAAATGTGCCTGTTTATTTTAGCTTTACTTTT
GTTTGGGTTCTGAGAAGGAGGAGGCTTATAATCCTCTGGGCTTCTTACCATCTTCCTGAT
GATTTTTC


invisible?    
Gene introns: 0  

>6155 128 226     7q31.33    chr7:126226348-126226475 BLAT!
CTACCAATGACTTTCTTCACAGAATTGGAAAAAATACTTTAAAGTTCATATGAACCAAAA
AAGAGCCTGCATTGCCAAGACAATCCTAAGCCAAAAGAACAAAGCTGGAGGCATCATGCT
CCCTGACT


invisible?    
Gene introns: GRM8 (126078651 - 126892428)  

>6165 142 226     13q31.1    chr13:86928289-86928429 BLAT!
TGCTCTACAGGTCAGTCAAATTTGCATCCAGGTCAGCAAACACATGGGAGGGGCCAAAGT
GATGGCAACCACAGGAGGAACCAATTTACGAGATGACATAATGAGGCTTGATGATACAGT
GCACGTGGTGATTGCTACCCCG


invisible?    
Gene introns: 0  

>6542 125 226     7p21.1    chr7:19303175-19303051 BLAT!
CATGAAGCATTACTCCAGTAAATAAACAAATGACAAACAGAAAATATTTCTGCACCAAAT
ATGACACAAATACATATAAGACTTATTTGCATGTTTAAGGGAAAAAGATCTCTGAAAAAT
GAAGA


invisible?    
Gene introns: 0  

>15852 115 226     6q27    chr6:165648504-165648390 BLAT!
ACAAAACGTGATATATCCATGTAATGGAATACTACACAGCAATAAAAAGGAATAAACTAG
TGATGCATGCCACAGAATGGATTAATCTTAACTACGCAGAGTGAAAGAAGCTGAA


invisible?    
Gene introns: 0  

>15876 110 226     5q12.1    chr5:61576201-61576275 BLAT!
GGAAATAAAAAGCATACAGCAAAAGTCTACAACTTTCATGATAGACTTTGTGGACAAGTA
GAGTTGCTTTAGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGGT


invisible?    
Gene introns: 0  

Shown 1561-1590 from 1945 sequences on 53 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs