Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1591-1620 from 1945 sequences on 54 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>17577 120 226     4p11    chr4:49636769-49636679 BLAT!
CATTCTATTCCATTCCGTTCCATTCCATTCCATTTTTTTCCAATCCATTCTATTCCGAAC
CATTCCATTCCATTCCATTCCATTCCATTCCATACCATGCCATTCCACTCGGGTTGATTC


invisible?    
Gene introns: 0  

>15193 134 225     7q21.3    chr7:94433685-94433552 BLAT!
CAGATCTCCTTTCTGTCAAAATAATTCTCTTCAAGAATTTGGTAAAACTGTAATCATACA
GTATATATTCCCTTGTATCTGGCTTCTGTGGTTTAACACAATATTTTTGCAATTTATTCA
TGTATCAGAATTAT


invisible?    
Gene introns: 0  

>15808 117 225     10q25.2    chr10:114690798-114690914 BLAT!
TGATAAGTTAGAATTTTATAGTTAGCAAAAAGATCTTTCAAAAATGAAAGCAAATAACCA
AAGACGGCAAATAAGCATATGAAAAGATGTTCAACATCATATAAAACTAGGGAATTG


invisible?    
Gene introns: 0  

>19709 135 225     12q21.33    chr12:89777903-89778037 BLAT!
TGGGAGGATCCATTCAAACCAAGCACCTCCAAGCTTGGCAAAGGATTGCTCTCTGAATGA
CGCCAGGCCTCACCCAGCTGCTTGGAAACAAGCTTGCATGAAGGTAGGAGGGAAAGGATT
GCAGAGAACCTGCTG


invisible?    
Gene introns: 0  

>20925 108 225     2p22.3    chr2:33910332-33910439 BLAT!
AGATTTTTTGAAGAGTTTCAGTAGGATTGGTATTAGTTCTTCTTTAAATGTTTGGTAGCA
TTCAGCAGTGAAGCCATCAGGCCCTGGGATTTTCTTTGATGGGAGATT


invisible?    
Gene introns: 0  

>22015 123 225     11q14.1    chr11:82845276-82845394 BLAT!
TGGCAGAGAAAGAACATGCAACTCACAGCTGGATCTAAATTGAGAGAAATGGAGTCAAAT
TGGGTATCCCTGGTCAGTAAGAATTATGAGATTGAACGGACTATTGTTCAGCTAGAAAAT
GAA


invisible?    
Gene introns: 0  

>7066 116 224     3p11.1    chr3:90251313-90251428 BLAT!
TTTTTTCCTTGACAAAGGACCTTTTAAAAATCCCAGGAAAGGACCACAAAATAATCAAAG
ACTGCACATTGTAAATAAAACCCTTCAGCTGTTATTGAAACATAAGTATAATTACA


invisible?    
Gene introns: 0  

>7727 106 224     6q24.1    chr6:141873181-141873286 BLAT!
TCTGTGCCAGTCCCTGGAGTGATCTGTCCCTTGCAGTATTTTTCCGCTGTATTCCATTGC
TGCTTTGATTTGATTTTTTGATACTTTAGTGTCGTTTTGTGAGCTG


invisible?    
Gene introns: 0  

>15201 138 224     5q13.1    chr5:67630888-67630751 BLAT!
CAGTCAGCAGCAGGGACTTGAAACTGCTCGTTTTATTTTAATCACCAAATCACTCAAGGG
AAAATTCACCAGTAATCAAAAATAAAACAAAGGGAAAATGAATATTGATTATCTTGACCT
GCAAGTAAAAACAATAAA


invisible?    
Gene introns: 0  

>15301 100 224     1p21.1    chr1:106433679-106433778 BLAT!
CTTCCTCATCACCAACCTCATCTAGAGTGACAAAACCTTCCATACTCCCTGGAAAACGAC
GCTTTTTAAGCTTTTTCTTTGCTGCTGCTGAAGCACTTCC


invisible?    
Gene introns: 0  

>17543 130 224     5q13.1    chr5:67320539-67320410 BLAT!
TCTAAGGTCTTTAACTTCTTGAAATTCCTCCTAAATTCAATTCTTACCTTTGATAAAAAC
AAAACAAAACAAAAACCCTAGTGACTGGTAACCTTTGCATGGTTTTCCAGCATGGATTTG
TTCCAGGTTT


invisible?    
Gene introns: 0  

>3022 120 223     5q12.3    chr5:66545110-66545229 BLAT!
AGTATCAAGAAACAACAGAGCAGGGGAAGAAAAACATTTAGGGAAAATCACCAAATGCAG
AGTCAGGAATCAAATTGAGATTTTCAGCTCCAAGTCTAGAATACCATGTTGACATTATAA


invisible?    
Gene introns: 0  

>4606 106 223     12q24.21    chr12:116112230-116112125 BLAT!
TGAGATGCCGAAACTAAATAGTAGCTGTGGGGTAAGGGGGAAGAGAGAAGAGAAGAGGAG
AGGAGAAAGGAGAGAGAAAGGAGAGAGGAGAAGAAAAGAGAGGAGA


invisible?    
Gene introns: 0  

>6313 130 223     10q11.21    chr10:45202973-45203102 BLAT!
ACTCCAGTGCCCAGGGGACACCTAGACCAAGGTTCGGGCTGTCTGAGAACCTCATTTAAA
GTTCTCTCTCTAATCGTCAGCTCAGCCACTAGAGCTGACAGGCATAAGCATAAAGTGAGC
TTGAGAGGTG


invisible?    
Gene introns: 0  

>9083 100 223     10q25.2    chr10:112864925-112864826 BLAT!
CAGGCTGCTGCTGGCTTTCATCACCACGTCATGTTCGATCTTCTTCCGGATTCCGACTTC
TAGGTTCTTCTTGAGCTTTTGCTGCTGCACGACGCGCGCC


invisible?    
Gene introns: 0  

>9152 124 223     12q23.3    chr12:108674971-108674849 BLAT!
GATGTCCCTTCCAGCCCTGGGATGGACTAGAGGAGCACAGCCAAGCCCTGAGTGGGAGGC
TGCGGGCCATTCTCCAGAATCAGGGAAACTGAAGGATGGGCCTCAGTCTCTAAGGAAGGC
AGAG


invisible?    
Gene introns: 0  

>16788 124 223     3q13.13    chr3:110593524-110593401 BLAT!
CCCAGATACAGCCCCAACTATTCCATATACAAAGAATTAGAAAAATCTGAACAACTAACA
GGCAAAAGAAAGTTAACAGACACCAACTACAAGAGGACTCAAAGGTTGGAATTATCAGGA
AATA


invisible?    
Gene introns: 0  

>19053 126 223     19q13.33    chr19:50634467-50634592 BLAT!
GGGATGTTGTATGTTTGTTTTCATTAGTTTCAGATAATTTTTTTATTTCTGCCTTAATTT
CAGTCTTTACCCAAAAGTCATTTGGAAGCAGGTTGTTTAATTTCCATGATGACTCTAGGC
CGGGCA


invisible?    
Gene introns: 0  

>20296 103 223     2q14.3    chr2:123038459-123038357 BLAT!
TCAAAAAAGGAAATTATACTGCACAATGAGAAGCAGAATGGCAGTGAAGAAGACTCTTAA
TGCAGCCAGCACCAGTTTCCTCAAAATGAGCAGTTTTAGCAGG


invisible?    
Gene introns: 0  

>21767 110 223     9q22.33    chr9:99400496-99400387 BLAT!
GTGTGGTGGCACATGCCTGTAATTCCAGCACTTTGGGAGGCTGAGGCGAACAGATCACCT
GAGGTCAGGGGTGATCAGCTTGGCCAGCTTGGCCAACATGGTGAAACCCC


invisible?    
Gene introns: 0  

>22716 118 223     5q34    chr5:165827825-165827708 BLAT!
GAGAAGAAGAGTCACCTGAGAAATTAAAGCACTGGTTTCCTTATCAATCATGGTGACATA
TAGAATTGACTATGGCTTTTGTTGGTTTGTTTGGCAAGATTTCTCTGGATCAATTTCA


invisible?    
Gene introns: 0  

>4346 113 222     8q23.2    chr8:110817064-110817176 BLAT!
CAAGGGAGGAAAGAGGGAGAGAAGAGAGGTTGGATAAAAGTAACTTAAATTGCAGTTCAG
TTGTAAGGAAAGCTTTTCAAGGACAATGGGGAAGGCTTGAGGCAAAATTGCTT


invisible?    
Gene introns: 0  

>4369 123 222     1p31.1    chr1:82522581-82522458 BLAT!
ATAAAAGAAGAAACTTTCACAAACAGGTGAAGCTGTATCATCACCCTGATTCATAGGGTT
ATTGAACATCCCAACCTCAGCAAAAAAAAAAAGCTTTACCACTGTCTGCAATAAGCAAGG
TTG


invisible?    
Gene introns: 0  

>5122 111 222     11q13.4    chr11:70997590-70997480 BLAT!
ACAGCACCACCTCACACTCCTCAGGATGGCTACTGTCAACGAGGTGGAGAATAACAAGTG
TCAGCGAGGCCATGGAGAAACTGGAACCCTTGCACACTGTGGGTGGGGATG


invisible?    
Gene introns: 0  

>11744 116 222     7q33    chr7:137877789-137877904 BLAT!
CCTTGTGTGCTTCTTAATCTTCCACTGCACCAAAGAATTGTTCTGTGCTGCCATCTTCAA
ACTAATAGGATCACCATTCTCTTTCCCTGGGCTTTTCCTGGGGCTGCGTGAATGCC


invisible?    
Gene introns: 0  

>4533 112 221     13q12.11    chr13:22346640-22346751 BLAT!
ATTGGAGTCTGTTTGACTTGAGAGCCTGGAATCGCCTCACACCATCTTGCCTGCCTCGCT
CTCTGTCTCTGTGCAATCTTTGATGGATTCGGTTTTTTGCCTGGAACACCTT


invisible?    
Gene introns: 0  

>10488 110 221     12p12.3    chr12:16929607-16929716 BLAT!
TTTTTTAATAGGGAGTCTCGCTCGCTCTGTCGCCCAAGCTAGAGTGCAGAGGTGCCACCT
CGACTCACTGAAACCTCTGCCTCCCAGGTTCAAGCGATTCTCCTGTCTCA


invisible?    
Gene introns: 0  

>12180 136 221     11q23.1    chr11:110688906-110688787 BLAT!
ATAAGCTCACCCATACTGAAAGGCAGAAAAATCAGATTCTATCGGGTGATGGGTCAGTGG
CAAGGTTGTGGAAGAGCATACAGGACAGGAGATACTGCTGCAGTCATCTTTGGAAAGTAC
TCCGTGGACGTTCGGC


invisible?    
Gene introns: 0  

>12277 107 221     2p12    chr2:81890747-81890854 BLAT!
GGAGACTTCAGGGAGTCAGTGGATAATGAAACCATCCCTTGATCAATCGCTGTGAAAGCA
GAAACAAGGGGGAAGGGTATAATGATTAGCAATTATTAGGTTGCATT


invisible?    
Gene introns: 0  

>17954 127 221     5q14.3    chr5:86998103-86998229 BLAT!
ATATTTGTTTGCTCCATATTTTCCTGTTTCTTTGTGCTTGACATTTTGTGTTGGTGTCTA
AACATTTGAAAAAACAGCCACTTCTTCCAATGTTTATAGATTGGCTTCCTACAGGAGACC
ATCTCCA


invisible?    
Gene introns: 0  

Shown 1591-1620 from 1945 sequences on 54 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs