Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 511-540 from 1945 sequences on 18 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>24684 182 908 145842+,203911-,115390+     18q12.1    chr18:29542276-29542147 BLAT!
CGCGGCCGAGGTACCAATTTCTCGATGAAATCATCCACAGCTTGCCCNNNNNCATTGGCC
AAGAAATCATCAACTTTGGAGACAGTCCTATTAAAAGCACAGACCACAAAGCCGTGGTCA
TTCATGTTCAGAATTAAGTTCTGGCCCATGACGGCCAATCCGATCAGCGCGATGTCAGCT
TG


invisible?    
Gene introns: 0  

>10909 191 907     Xp21.3    chrX:27536927-27537117 BLAT!
GTGTTGATGCTTTGGGTCTGAATATTTATGAGCATGACGACAAGTTAACACCTAAAATTG
GTTTTCCCTGGAGTGAAATCAGAAATATTTCATTTAATGACAAAAAATTTGTTATAAAGC
CAATCGACAAAAAGGCACCTGATTTTGTGTTTTATGCACCTCGTCTGAGAATCAATAAGC
GGATTTTGGCC


invisible?    
Gene introns: 0  

>6805 206 906     11q12.1    chr11:56495794-56495999 BLAT!
TTCATATTTTCTCCCTTTTGATCAAGACTTTCTCCGAAGGCATCACTGAACAATAATCAT
GTAGCTAGATTTTGATATCCCTTCGTGCTGGAATGGACCTATGCCTGGGCTGGTCTCATC
CCACCTTAGGGGGAGAGTTTGGTGACTAGCAGTCAGTGTTAAAACCTCTTTAGCCACACT
GAGCAACAAGGGAAGTTTGAAGGGAG


invisible?    
Gene introns: OR8U8 (56143099 - 56508560)  

>22999 201 904     7q22.3    chr7:105245329-105245128 BLAT!
CACCTTATATTTTGTTATGCTGTCGGCCCATGGCACTTTAACAAAACTCTGTGGGTTTAC
GTAGCTGGTCAGTCATGGGGTATATTAAATAACTGTTGTTGCACAGACAAGAATTTGCAC
CTGCTCATTTGTCCTTTCCTACTACCAATTTTAGAACCTTTTCCAGAAAAATTTTGAAGA
AAGCATGTCCGATCATTCTAA


invisible?    
Gene introns: ATXN7L1 (105245220 - 105517031)  

>1014 136 903     21p11.2    chr21:10848998-10849091 BLAT!
AATGGAATGGAATGGAATGGAATGGAATGGAATGGAATTGTTCCGAATGGAATAGGAGGG
AATGTATACGAGTGGAATGGAAAGGAATGGAATCAATCAGAGTGGAATGGAAGGGAATGG
AATGGAATGGAAACTA


invisible?    
Gene introns: 0  

>21588 191 902     Xq26.3    chrX:135377963-135378092 BLAT!
CCCTCGCAGCTCTTCAATGGACCCCAAGTTCCCTCCGCACGCCTGGCTCTTCTCCTTCAA
CTCTGCAAACAGAGGAGAAATAATTGTAGATAAACACTGAGAGAAAGGCCTCTTTGGGAT
GTCTTTCATCTTATTTCTGTCCAAGTCCGATGGCTGAAGAGCTCCATTCTCGAGATTCTT
GGGATCTTTTT


invisible?    
Gene introns: 0  

>6910 180 901     17q24.1    chr17:62849781-62849960 BLAT!
CACTGCTCCTGGGAAGGTAGGGGGGCTGCTGTTCTGCAATTAGCACGGTTCTTTACCTCC
TATTACCGAACTGCCAGAGTTCATTTGTGTTCAGTTAGGTAGATGACCAATTCTTGTTCA
TTCCTATTTTCTTTTGCTCACTAATGTGTTTAACGTTCACTAACCTACCAAATGTGATTT


invisible?    
Gene introns: 0  

>6715 194 900     7p12.3    chr7:48943096-48943271 BLAT!
TTTTCAAACAATCCCATTAGGCTAGATGCCAGGGCTTCTGCTTCAGTGGAAGGAACCTTG
TAGATTTTTCCACCCTTATAGACAAAGCTCCCTTCAGTCACTTTAAAATCCAGATAGCGA
GTTACCTCTGTATAAAGCAGCATCTTAACCAGCTGACCATTAGCCATAAGGAACTTGGGA
ATCAAGTCAACATT


invisible?    
Gene introns: 0  

>9763 175 900     19q13.43    chr19:57406459-57406285 BLAT!
AAACCTAAAAATAAAATAAAACATAAAAATAAAAGCATATGGACTTACAGAATTGTGGTC
AGGGTAAAGTAAGAAAATCTATGCAAAATACACAAAATTGTGTCTCATGTTTCGAAAGCC
CCAAATAAGAGTGAGCTAAGAATAGCCTCATTTCCTGAATGTTGAATAGAAAGAA


invisible?    
Gene introns: 0  

>10990 224 896     5q14.1    chr5:81188478-81188352 BLAT!
TAGAATGTATTAAGCAGGTCAAGTTTAGGTTACTTCAACACTTCTTCTGGATGCTATGAA
GTCTCCATCTTATAACCATGTTTCTCTAGTTCAGCTCGTAACTGATTAGAGAAGTCATCC
TCTACATTGTCATCATCCCAATTATCCTCCCAGACATGTGCATCTTCATCTTCATCTAAG
CCAGCCCAGTCTTCGGCAGGGAACTCTTCAAACTCGTCGTCTTC


invisible?    
Gene introns: 0  

>15111 183 896     2q32.3    chr2:196200779-196200597 BLAT!
GAGGGGTCCTAGGACAGGCAGTCATTAGATACTTCTCCCAGCCACTACTTGTGACTGGGG
AACTTTACTCTTTTCTTATGCCTTTCTAATTATGCCTGAAAGCCCCACTCCTTTGTTAGG
GAGAGACATCCTAGCAAAACCAGGGGCCATTATACACTAGAATTAGGAGAAGGAAAAAGG
GTA


invisible?    
Gene introns: 0  

>16664 171 896     17q21.2    chr17:40685617-40685787 BLAT!
CCCTACCAATGCTACTCTCAACAAGTTCACAGAGGAACTTAAGAAGTATGGAGTGACGAC
TTTGGTTCGAGTTTGTGATGCTACATATGATAAAGCTCCAGTTGAAAAAGAAGGAATCCA
CGTTCTAGATTGGCCATTTGATGATGGAGCTCCACCCCCTAATCAGATAGT


invisible?    
Gene introns: 0  

>4422 237 894     5q15    chr5:97912891-97912655 BLAT!
TGTGCCACTGTCGGGAGGTTGTGAGTCACTGGGATGCCTCCAGGGATGATCCCTTCCATG
GCTGCAGGAAGTCCTCCTGGAGCCACACCCACGATGCCTGGCGGATATCTGTATGTGGCA
CCATTGAGCTCAGGATGAATTGCTTGCTGGTCTATTACTGACCAAGGCGCTGATGTGACA
AAGAATTCCTTGTTCACACAATTTCTTAAGCTTTCTGGGATGCGACCTGTGATGGCT


invisible?    
Gene introns: 0  

>20855 202 892     8p23.2    chr8:5706527-5706326 BLAT!
AAGAAAGCTTTTTCTTTCCCTTGGGTTTTCCAGGTTTTGCTGCGGAACCCCCTGGCCAAG
GCAAAGATCCAGCACCATCTGGTGTAGAAACCAAAATCTGACAACGCGTGAGAATGGCCA
GGAGGAAATCATTGTGAGAATGGACATTATCCTGTGTGAGAAGTCTATGAGCTTCAAGGT
CAAACTCCTCTTTGCTGATCTT


invisible?    
Gene introns: 0  

>13172 314 891     Xq21.31    chrX:91368456-91368769 BLAT!
GCCTCTGGCCAGCAGGTCAGTGGTAATCAAAACTCTGCTAGAGCCAGAACGAAACTCCCT
CATAATCACGTCTCGCTCCTTTTGGTCCATATCTCCATGCATGGCGGATACAGTGAAATC
TCGAGCATGCATCTTCTCGGTGAGCCAGTCCACCTTCCTCCGGGTGTTGATGAAGATGAC
TGCCTGGGTGATGGTCAGGGTTTCATACAAGTCACATAGTGTGTCCAGCTTCCACTCCTC
TCGTTCCACGTTGATGTAGAACTGGCGGATACCCTCCAGGGTCAACTCTTCCTTCTTGAC
AAGAATCCGAATGG


invisible?    
Gene introns: PCDH11X (91090459 - 91878228)  

>4077 187 890     12q21.2    chr12:77592954-77592768 BLAT!
ATAAAAAATACGGTAACAAAATGAATATGCCCTTGCAGAGTTGATAAGTATAATTGAGGC
AGCTGAGAAAAGAATCAGTGAGAGACCAGCTGGCCAACATGGTGAAACCTCCTCTCTACT
AAAAAACACAAAAATTAGTCAGGCATGGTGGTGCATGCCTGTAGTCTCAACCACTTTGGA
GGCTGAG


invisible?    
Gene introns: 0  

>12550 286 889     18q22.1    chr18:65920830-65921055 BLAT!
AAATGAGAGAACACATGACAATCTAAAAAAGAACTTGGGAAGGTTTTCTTTTAAGACATT
TCACATTCCCACCAACAGTGTAAAAGTGTTCCTATTTCTCAACATCCTCTCCAGCACCTG
TTGTTTCCTGACTTTTTAATGACTGCCATTCTAACTGGTGTGAGATGGTATCTCATTGTG
GTTTTGATTTGCATTTCTCTGATGGCCAGTGATGATGACCATTTTTTCATGTGTCTTTTG
GCTGCATAAATGTCTTCTTTTGAGAAGTGTCTGTTCATATCCTTTG


invisible?    
Gene introns: 0  

>6075 212 886     Xq28    chrX:149284583-149284790 BLAT!
TTGTAATGATGCCAGAAGCAAAGAGGCTACTGATAAATCTTTACAAGCTTGTAAAATCTC
AGATATCTGTTTATTCTGAGCTCAACAAGATTGAAGTAAGTTTTCGGGAGCTACAGAAAT
TAAATCAAGAAAAGAATAATAGAGGATTATATTCAATTGAAGTGCTGGAGCTCTTCTGAT
ATTATCAATTCTCCTTCATAGACATTTTATAA


invisible?    
Gene introns: 0  

>10534 104 886     Yq11.221    chrY:16186520-16186417 BLAT!
TTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTAGCCGGGATGGTCTTGATCTCCTGA
CCTCATGATCCACCCACCTTGGCCTCCCAAAGTGCTGGGATTAC


invisible?    
Gene introns: 0  

>21706 166 883     3p26.1    chr3:5104903-5105068 BLAT!
GGACAGGATGCCATCCCATCGCAGAGTGCACTCTCACACACACACTCACTCACTCAGACT
GGGACAACGTAGACATGCCAGTCCACCCCACGTGCACAGCTTTGGGGTGTAGGAGGACTG
GAGGACCTGGAGAAACCCCATGACATGGAAGGAACATGCAAACTCC


invisible?    
Gene introns: 0  

>21293 118 882     3p14.1    chr3:63990478-63990388 BLAT!
AAGACAGATCTTTGAAGCAAAAGAGAGTGAGAATGCAAGACATGGGGAAAGAGACTTAAG
TGCTCCTTTGCTTTTCCACAGTTTTCAGTACCTCGGCCGACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>16123 228 881     21q21.3    chr21:30122101-30122328 BLAT!
TCTGTAAGAAATTAAAATGAACATAACCAGAGAGAGATAGGGTATCTCTTACGAGAACAT
CAGAGGAGCGTCTACAGCCATGTAATGTTGACATTCACTTCCAAAAACTGGCATATTCTC
TAAAAGGACAGCAAACTGGATTGACATGCCAAAACCACTAGTTGAAAAATAAAAATAATC
CGTTATTAAGTCAGTTGTTTTGTCATTGCTATTTTCACCAATCTAATT


invisible?    
Gene introns: 0  

>85 252 879     3q26.33    chr3:179182493-179182722 BLAT!
CGCCCGGGCAGGTACGCGGGGGAATAATGATGATAATGTAGATGGCCTCCTTGTTCAGTT
GCCTCTTCCAGAGCATATTGATGAGAGAAGGATCTGCAATGCTGTTTCTCCAGACAAGGA
TGTTGATGGCTTTCATGTAATTAATGTAGGACGAATGTGTTTGGATCAGTATTCCATGTT
ACCGGCTACTCCATGGGGTGTGTGGGAAATAATCAAGCGAACTGGCATTCCAACCCTAGG
GAAGAATGTGGT


invisible?    
Gene introns: 0  

>8680 271 879     7q31.1    chr7:113249964-113249694 BLAT!
CAATTAGCTGCTAGCTTATAGCTTTTAAAAATCTGGAATAGAATAAAAAAGCCTCCAATG
AAATGCTACACAAGACCAATAAGTTTTGATGAGGGCATGGGAAAGAAAGATAACTGAACC
ATCTAGTTTTGTTCAAAGAGCAGATCCAAGGGTTTAGGCTATATGTCAAACAATTCTGAC
TGGATGTTTCTCAAGTAATACAAAGGACATGTTCTCAATACATATATAAGACAGTCACCA
TTCTACAAGTTACACATATTAACTTACTTAA


invisible?    
Gene introns: 0  

>1179 174 878     3p11.1    chr3:88019315-88019488 BLAT!
AGTAGTGGGAATTTGAGCAAAGATTTGAAGGAGTTGGAGTTAATTAACCAAGTGGTTATC
TCAGGTAAGATACAGGGGAACAGCTAGAACAATAGTTCTAAGTTAAGCATGTATCTGAAT
CCTCTGGTGGGGGCAGGGTTTAAAACACATTGATGAGTTTCATTCCCAAAGTTT


invisible?    
Gene introns: 0  

>24292 325 876 104104+,203797+,145311+     16q22.1    chr16:69791242-69791571 BLAT!
AGCTTTCCGAGCAGCTGGCTTCCCTGAGAACTCAACAATGCCTTTTCCTGAGGGCCTTCC
TCGATCATCCACAATGACTACAGCCCTCTCTACCTGGCCAAACACAGAAAAGGCTTCTTC
CAGCAGTTCGTTGGACACATACTGAGGAAGGTTTCGAACTGTAAGGGATGCACTATGGCA
GGCAAAnACGCAGCTGCTTTCCACGGAGTGGCATATTGTCCAGCTCCACTTTGGCAATCT
CCGCTAGGGTTCGGGTTTCCAAGCGGATAAAGCCAAATCCTTTATCCTTATGAATGAAGA
CTTCGCCTGCCTTTCCATATTTCTC


invisible?    
Gene introns: 0  

>8307 185 871     4p16.1    chr4:10962499-10962315 BLAT!
CTTCTGGCCATAGTCCTGATAGTTCCAGCGATCTCTCTAGGACCAGGGCAGCAGGTCCCA
CATGTTCATAAATTACTTAGTTTGCAGAAGGAATTGCCTGAGGGTGTAATTTCAGTATCT
ATTGCTCAGAAAGTTCTCATACTTAAATTTTTTGTAGCTGCCAAATGGATATCAATGGGC
TGTTT


invisible?    
Gene introns: 0  

>19311 174 870     9p23    chr9:10961738-10961911 BLAT!
TGTGATTAAGGTCAATGGGAAACCACAGCAACCCAATTCAGGCAGGACTACAGATGGTCC
AGACCCTTCAGGAATGAAGATTTGGGTTACTCCATCAGGTAAAAAACCATGACCTGCTGA
GGTGCTTGCTGAAGGCAAAGGGAATACAGAATGGGTAGTAGAAGAAGCTAGTCA


invisible?    
Gene introns: 0  

>15264 188 867     6q22.31    chr6:118748367-118748180 BLAT!
TGCTGTGCTAGCGATCAGCGAGACTCCGTGGGCATAGGACCCTCTGAGCCAGGTGTGGGA
TATAATCTCCTGGTGCGCTGTTTTTTAAGCCTGTTGGAAAAGCGCAGTATTAGGGTGGGA
CTGACCCGATTTTCCAGGTGCCGTCTGTCACCCCTTTCTTTGACTAGGAAAGTGAACTCT
CTGACCCC


invisible?    
Gene introns: 0  

>17712 208 866     6p24.3    chr6:10026384-10026591 BLAT!
TTTCTTATAGTTTATTTAGCCAATTTACACAATGCTGTTGATTACAATTAAAATATTCTG
CATATTGATTTATGTTAGAAAAAAAGTATAAAATCATTTTTACTGACCATGAAGTCGTTA
TTATTGATTTCAACGTAAATTCTTAGACTTGCCTACTGAGATCACAAATAAGCTTTTCCT
TTCTTAGAAGCTTTAGATATGGCTCATT


invisible?    
Gene introns: 0  

Shown 511-540 from 1945 sequences on 18 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs