Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 571-600 from 1945 sequences on 20 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>14493 249 822     3q26.33    chr3:179182493-179182728 BLAT!
AGGTACGCGGGGGAATAATGATGATAATGTAGATGGCCTCCTTGTTCAGTTGCCTCTTCC
AGAGCATATTGATGAGAGAAGGATCTGCAATGCTGTTTCTCCAGACAAGGATGTTGATGG
CTTTCATGTAATTAATGTAGGACGAATGTGTTTGGATCAGTATTCCATGTTACCGGCTAC
TCCATGGGGTGTGTGGGAAATAATCAAGCGAACTGGCATTCCAACCCTAGGGAAGAATGT
GGTTGTGGC


invisible?    
Gene introns: 0  

>5366 181 820     Xq21.33    chrX:94145186-94145366 BLAT!
TAGAAAAGTAGCTAGCATGGCTCCCAGTCCAAGTCCAAAGGCAACAGAATCAAAGAAGCC
AATGGTGTAACTCTCAGTTCAAGGCCAAAGCCCAGAGTCCAGAGGCTATTGTTGCAAGTC
CTGAAGTTCAAAAGCCATAGAACCCAGAGTTCTCAAGTCCAAGGGCAAGAGAGGGAGGGT
G


invisible?    
Gene introns: 0  

>24312 236 819 105843+,203505-,76651+     6q14.1    chr6:80711236-80711388 BLAT!
GATCAGCAAAAAAGTTTCATGATGATAATGACAAAGTTAAACATTCGAAACTTTTGTTTA
TGTGACAAAAATGTGAAACTTACCATCTTACAATAAGTCATAATCTTATGGCTAATTTTA
TTGCTTTGTGAAAGGCTTGACTCTGAAAATGAAnGGTTGTAAATATTAGTATTTAGCTAA
CATTTATTAAGTGCCTACAAATGTACCTGCCCGGGCGGCCGCTCATAGATCGGAAG


invisible?    
Gene introns: 0  

>4933 223 818     19q13.2    chr19:40529903-40529699 BLAT!
TGAGGGCTCTTTGGGAAAGCTTACCGTTTCTAGTGTGAATAATCCCCGAAAAATGATTGA
TGCTGTTGTGACATCTCGGAGTGAGGATGATGAGACAAAAGAAAAACAAGTTCGAGACAA
GAGGAGAAAAACCCTTGTTATAATTGAGAAAACCTACAGCTTACTCCTTGATGTGGAGGA
CTATGAAAGACGTTATCTCCTAAGTCTGGAAGAAGAGCGACCT


invisible?    
Gene introns: 0  

>18952 131 818     Xq25    chrX:126481129-126481259 BLAT!
AGGGTGGTGTCTGTGATTCAAGACTGTTTGTTCTACGTTTAAAGTGCCTCTTTCAGTGAT
ACTAAGTAAGATTGAGGTATTATGAGGGCTCACCTAATTTTGGGGTCTTATGAAGGTGGT
TTTTTGTGCAG


invisible?    
Gene introns: 0  

>23085 174 817     11q14.1    chr11:77372408-77372583 BLAT!
TATGCTGTTAACAGCCAAATCTGGGCTACTGTAGCTGTTCTGATCCTGAAAATCCATTTA
CTAATATAAGCTAGATGTGTGTGTGTGTGTGTGTGTGTGCAATTTTCATGCAGTGACCTT
AAAGCTTTGGAGACAGGGCTTGTTACTCTAATTTCAAGGCTTGTCCACATAGCA


invisible?    
Gene introns: 0  

>12778 170 813     Xq12    chrX:64643426-64643257 BLAT!
GGTGATCATTAAAAAGTCTGGAAACAACAGATGCTGGAGAGGATGTGGAGAAATAGAAAT
GCTTTTACACTGTTGGATGTGTAAATTAGCTCAATCATTGTGGAAGACAGTGTGGTGATT
CCTCAATGATCTAGAACTAGAAATACCATTTGATCCAGCAATCCCATTAC


invisible?    
Gene introns: 0  

>1097 166 812     3q29    chr3:195202268-195202103 BLAT!
TGATATCATACAGAGCAGCTTCACTATATCTACCACTGTGAGATCACACAGAGGAGCTTC
ACTATATCTACCACTGTGATATCATACAGAGGAGCTTCACTGTATCTACCACTGTGGTAT
CATATATAGGAGCTTCACTATATCCACCACTGTGATATCACACAGA


invisible?    
Gene introns: 0  

>3044 186 811     17q22    chr17:52381552-52381737 BLAT!
TCATCATCTCTCTATGGAGAGTGACAAGTTTTTAGAGAGTTACAAATAAATTTAGCATCT
TTTCAGCGATTCATTTTGCATTAAGAAAAACCACAGCCACTGAATAAAAAATAAAAAATC
CTTGAGGACTCTACTTCATTTTATGCCTAGTGGCAAATATTACAGGATCATGCAGGCAGT
TAGAAA


invisible?    
Gene introns: 0  

>24191 303 811 95215+,203150-,49623+     11p14.1    chr11:27816450-27816285 BLAT!
CCAATCTCTACAAACAATTAAAAAAATAAGCAAAGTATGCTGGTGCCATCCTTGTATAGC
CTGCAGAACTGTGAGCCAATTAAACTTCTTTTCCTTATAAATTATCCAGTCTCAGGTATT
TCTTTATAGCAATGCAAGAACAGCCTAACACACTGGTGGACATTCCTTTATAAGTATATC
TGTGATCTGATTATTTTTCAGGnCTTATAGTCTTTGCACTTCTTCTTCTTCTTTGAGGCA
TCATATTCTCCCTTCAGTTGAAACTTTGCCACCTCCCCCGCGTACCTGCCCGGGCGGCCG
CTC


invisible?    
Gene introns: 0  

>19057 222 809     2q11.1    chr2:95731924-95731703 BLAT!
AGGTTACATATTTCTCAGCTGATAAAAATATCGTGACCATAGGCTCATAAGAACCTAATC
CTATATTTATCGTATGAGCAGCAGTTCAGTATTCTCTAATTCAGTGTTTGTGTTGAATTT
ATAGAACATAACTACTGTGGTTAACAAGAATTGCGTCTGTCTATCTATCTATCATCGTCT
AATAGAAAATATGTAAAAGATTTGAATGCACACTTCACAAAA


invisible?    
Gene introns: 0  

>5890 199 806     22q12.3    chr22:34772761-34772563 BLAT!
ATTCTGTCCTGGCAAGGCCTGCATAGCCCAGTTTTTTATTACTACTGATCCTACTAAATC
AGTTTCATAATAATCCCTTGACCCTAATATCTGATCTCCCTTGGTGCTTATCCCCTTACT
CCAGATATATGATCAACTTTGATATTTGATCAAGTTCATCGCCTGCCTTTGATTTTCTAA
GTTCTTGGCCTGCCTTCAA


invisible?    
Gene introns: 0  

>17459 234 806     7q35    chr7:143262516-143262749 BLAT!
TGGCCCAGAGTGGGAAAAGCTGTTGGCCACACATGTAACTGACCAAGTTCATATATCTAA
AACATTGTGACATACAGAAAATCCGATAGAAAAATACACAAGAAAATGGAATGAGCACTT
CAAAATAAAAGCAAAAATCAAATGTTTAGTTAATATATGCAAAGCTGCTTAACATCATTA
GTAATGAGGAAAATGCAAATGAAAACCACAATAATATATTACTATGCACTCATC


invisible?    
Gene introns: 0  

>14891 167 804     7q31.32    chr7:122567058-122566891 BLAT!
CTAAGACGATGATTCTTTTGTTATTTTTTAATTCAAGTCTTTTTTTGACAGACCTAGAGT
GTTATTTTTGTTGTTATATAGTTCAAATGAAATGTTAATAGATTGCCCATATGGTTTAGT
CTTAAAGATCTCATCATCAATTAACCCTATGTGTCAGATAATGTTGA


invisible?    
Gene introns: 0  

>2626 206 803     6q15    chr6:93051776-93051981 BLAT!
TGTTACAAAAACATTTGAAATGAATAGCACAAATATTCAGGTATGAGGAGTCTCTGTGTT
TTCAACCTTGCGTCTTATGTTGTAGTCCAGTGGCTTTGGATATTTCCAGCTAAGTGTGGA
AAAACACATTTTAGCTTATGCTACCAAAGAGTTAGGTGCTATGTTACTCAGTAAGGTGTC
TCTGCAGAAAACAATCAGTAAATGGC


invisible?    
Gene introns: 0  

>12563 168 802     15q21.2    chr15:49827484-49827651 BLAT!
TGAATAATTATATGCCATCAAATTGAAAAAACCTAAATGGAATGGACAAATACCTAGAAA
AATGCAACCTATTAATATTAATCAGGAAGAAATAGGAAGCTGGAACATACCAACAACAAA
TAAAGACATTGAAAAGGTAATTAAAAACCTCCCAACAATGAAGAGCCC


invisible?    
Gene introns: C15orf33 (49620591 - 49913118)  

>10029 155 800     10q11.23    chr10:52487002-52487156 BLAT!
TCCCACCCAAAAAGAATAACGGGTGTCTACAGGCTTATTAGGTCTTCCATGATAACTATT
TTGTTGCCCCATTATACACCACCTCTTTATCGTGTTCAATTCTTTTTCTGAAAAAACTTC
TAGTTTACCCATCAGACATAGTGAGGCAATGCCAC


invisible?    
Gene introns: 0  

>14650 141 798     15q22.2    chr15:62236564-62236704 BLAT!
AAAGACCTGGAATCAAACTAGGCGCCCATCAACAGTGGACTAGATAAAGGAAACGTGGCA
CATATACACCATGAAATGCTACACAGTCATAAAAAAAGAATGAAATCATGTCCTTTGCAG
CAACATGAATGCAGCTGGAGG


invisible?    
Gene introns: VPS13C (62144589 - 62352664)  

>521 146 797     11q12.1    chr11:56495828-56495973 BLAT!
CAAAGGCATCACTGAACAATAATCATGTAGCTAGATTTTGATATCCCTTCGTGCTGGAAT
GGACCTATGCCTGGGCTGGTCTCATCCCACCTTAGGGGGAGAGTTTGGTGACTAGCAGTC
AGTGTTAAAACCTCTTTAGCCACACT


invisible?    
Gene introns: OR8U8 (56143099 - 56508560)  

>17869 170 797     1p13.1    chr1:116407700-116407531 BLAT!
CTAAACAATGCTGTGAAGAATGAGGCAACCATTAGAAGAAGCAGGGAAGTAATGAGCGCA
GTCAAGGAGGCAGCAGAACAATGACGACAACAACAAAGTGGTCCAAGAGCCGGTTTTTAG
GGACTGCTTAGTAACCACAGCATAGAGGCTGCTACTAGTCTGTCTCAAAA


invisible?    
Gene introns: 0  

>17193 204 796     10q23.32    chr10:93792444-93792241 BLAT!
TTTTTGTATTTGTTTCTGCTGGGGTGCCAGAATTGATTTTATTTTCTTGACTTGTGGTTC
TTACAGTATAAAACACTTAGCATAAACCCAGACCTTACACTTACACCCATGGTAAAGGCC
TGGGATTCTGATTTCATATAGATAACTTTGTGTGTGTGCTCACGGATCTAGTCCTACTTG
AATATGTGATCTCTTTGCAGGTTT


invisible?    
Gene introns: 0  

>8945 209 789     12q24.21    chr12:116137708-116137916 BLAT!
TAGTTAGATCCTGTTCTGATTCCACCCTAACAACAACTTGCCTACTGGTTCATTATTATA
CTCATTTTCTAGATAAGGTCACTGAGGCTCAGAAGGACAAAGGGTTTGAGCATATTCTCC
TGGCCTATAGGTAACGAAGGCAGGACTCTCATTTTGCCATCTCTCTCCCAACTTCTAAGT
TATATGTGCACTTGGTAGATACTTGACAA


invisible?    
Gene introns: 0  

>12860 173 787     6p24.3    chr6:9681966-9682138 BLAT!
TTGTGTATTTTGGATTTTATTACCTGTGCTTTTGGTGTTATATCCAAGAAATCATTACCA
AGACCAATGTCATCAGGTGTGAAAGCCCTCTGTGTAATCTCCATATGCCAATTCCTATGA
TATAACATGAAATAGGAAATGTTTTGAACATATACTTAGAGATTCTGAGATTT


invisible?    
Gene introns: 0  

>22007 234 787     7q32.1    chr7:128303004-128303237 BLAT!
TATTTACCCAATGCCTATACCCCCATTGTATCCAGGAAGTAACTAACCTGCTTTTGATTT
TACAGGCTCATAGGTGGAAGGGACTTGCCTTGTCTCAGATGAGACTTTAGACTGTGGACT
TTTGAGTTAATGCTGAAATGAGTTAAGACTTTGGGGGACTGTTAGAAAGGCATGATTGGT
TTTGAAATGCGAGATCATGAGATTTGGGAGGGGCCAGGGGCAGAATGATATGGT


invisible?    
Gene introns: 0  

>6764 178 785     11q12.1    chr11:56495778-56495599 BLAT!
AATGGAGTCACTAATATAAAAAAAAAAAACTCACAAAGCGAGCTGGGGAAAGCATGAAGA
GAGGGTTCTCAAGATTGTATGCCTGAGAACAAAACCATCACAAAAGATTCTGCAAAAAAT
AACAGGCTTGCACCAAGTCCATCACAACCTTGCATAAAAAGTATTTCTGCAATTATAA


invisible?    
Gene introns: OR8U8 (56143099 - 56508560)  

>23031 227 785     11q14.2    chr11:85907262-85907036 BLAT!
TTGAAGGGATCTTCCAATGTATCTCCAATATTCCTTTCTTATAGTGTCCTTTTCTTTAGC
TAGGATTTCACATAACTCTAATGCTTTATTAAGAATGTCTTCCTTATTGTCACACTGATT
TTCTAGCATGTCTTCATAGATATCCACAAGAAAGGCAATTAGGTAGGGGGAACTATGACT
TGGTTGTAAATCAAGTAATTGATTTAACAGATTAGGATATTTGGAAA


invisible?    
Gene introns: 0  

>2874 214 783     11q24.2    chr11:125937861-125938074 BLAT!
GGCCAAGATTGAAGATGAGAAAAAGGATGAAGAAAAAGAAGACCCCAAAGGAATTCCTGA
ATTTTGGTTAACTGTTTTTAAGAATGTTGACTTGCTCAGTGATATGGTTCAGGAACACGA
TGAACCTATTCTGAAGCACTTGAAAGATATTAAAGTGAAGTTCTCAGATGCTGGCCAGCC
TATGAGTTTTGTCTTAGAATTTCACTTTGAACCC


invisible?    
Gene introns: 0  

>10443 188 783     5p13.1    chr5:39584253-39584066 BLAT!
CTTTGATTTCTAGCCAGCAAGAGTAGCCCCAGAGACAGGTATCAAACTCCAGCAGAGCCA
CCCCCATAGATCTCATGTGTGGCAGCAACTGCCAGGATGAGAAAGTTCAACCGTGCTCTG
GCCTTACAGGATCCATTTAGCCTTTGGTTCCCCTCAAGGCTTCCTGGCAAGCAGAATACA
ACCTGAAA


invisible?    
Gene introns: 0  

>15790 181 781     17q11.2    chr17:31785413-31785593 BLAT!
TTTTAAAACTTTTATGTTTGGAGTTTTTTCACATGTTTGACTGGGGAGCCAGGAGAGTTG
GGTTTTAGTGAAAGGCCAGAACCATAATGGGCTCTGAAGTTGGACCGTTGGGTTTGAATC
CCATCTCTATCACTTTCTGACTGTATGATTTTGGCCATAGTTAACACCTCTGTGCCTCAG
T


invisible?    
Gene introns: ACCN1 (31340105 - 32483825)  

>13909 231 778     4q34.1    chr4:174055123-174054892 BLAT!
TTCTGCAATATAACCCCTTCTCACCTTTAATCTCCCGAGGCCCTTTCCTGCCCCAAATAC
CAGGTAATTTTACTAAATCATAATGCATTTTGTTAGCAGCATGGGGAAAGGGACTAAATG
AATGTTGGATCATCTATTATGCCAGTGGATAAATTACAAAGTGCCATTTCTCCAAATCAA
ATGCATTGCAAATCAAACCCTGCAGTAGCTGCAAAAAGCAGACATTGCCTG


invisible?    
Gene introns: 0  

Shown 571-600 from 1945 sequences on 20 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs