Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1531-1560 from 1945 sequences on 52 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>12442 151 242     Xp22.13    chrX:17403616-17403466 BLAT!
CACCCAGGTTGGTATGCAGTGGCATGATCTTGGCTTACTGCAACCTCCACCTCCTTGATT
TAAGCGACCCTCCCATCTCAGACTCCTGAGTAGATGGGACTACGGGCACATACCATCATG
CCCGGCCAATTTTTGTATTTTTTGTAGAGAT


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>22672 132 242     9q31.1    chr9:107610053-107610184 BLAT!
CGTCTAACCCTTTTCTTTTACTGAGCATTTGCCAAACGGCAAAATAAAAGATAATACTAA
GTGGATGAAATATACATGATATGCATAATAGGTTGTGTATAGATATACTATATGCATCCA
TGTATGTTTTTA


invisible?    
Gene introns: ABCA1 (107543283 - 107690527)  

>22724 116 242     13q22.1    chr13:75321756-75321871 BLAT!
CCAGGCCCCTTCCCAGTTTGGAGCGGGTATTAAAGTCCCAGGATTTTCTTATAATAGTTG
GCATCGTGAACAGGACCCCAGAGATCAAACGATGAGTCAGGGAGGAGTATCTGCAG


invisible?    
Gene introns: 0  

>21232 101 241     14q23.2    chr14:64235367-64235267 BLAT!
GCTTCTTTCTTTGTCCTGGCTGCTAAGAGTTTGAAAAACAATTTTATGTTTGATTGCTAT
AGATTTTCTTTAGCAGCAACTGAGCAAAAAAGTTTCCTGAT


invisible?    
Gene introns: 0  

>18736 145 240     7q31.33    chr7:124442035-124442179 BLAT!
AAGAAGCACAAGTTTGTATTTAAAAATTTCTAAGTATAAAACTGAAGAAAAAATATTGCA
TTGTAGATTGTTTAGCACATTTAAAAAGCCTATTCCCATTTTCCCTTTCTCTCTCTTTCT
TTTTTTGTTATCCTATACGACTTAA


invisible?    
Gene introns: 0  

>20561 130 240     1q42.2    chr1:231294819-231294948 BLAT!
AGGAAATTTAAAGTTCAGTGAATTTTATCCCCAAAGTTTATAATAGGGAGAAACAGAGGT
TCAGAGAACTAAAATGACTTCTCTATATGCATATGGTTCATGGCACAGTTGAGACAGAAA
GAGGACTTTT


invisible?    
Gene introns: 0  

>9497 104 239     4q31.3    chr4:151930591-151930694 BLAT!
CTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCCAGGAAGTGGAGGTTACACTGAGCCA
AGATCGCGCCACTGCACTCCAGCCTGGTGAGGGAGCAAGACTCT


invisible?    
Gene introns: LRBA (151185595 - 151936649)  

>13761 113 239     18q12.1    chr18:25247727-25247839 BLAT!
AGAAGACCCTACAAATTCATTTTCTCTCCTTCCCTCTACTGACTCCATCCTCACACAAAA
ATACATCCATTCCAGCCATTAGCGCTTGCAGTAATTCTAGGATTTGCTTTGCT


invisible?    
Gene introns: 0  

>16174 117 239     5q32    chr5:147328428-147328355 BLAT!
TGCAACTGACCCCAGAGCTGAAACTTTTTGCAGTATACTGCACTGGCAATCTTCTGGTAA
TCTCTGTATGAAAGCCAGTGAGAATGGCTGTTATTAAAAAGACAAAAAATAGGGAGC


invisible?    
Gene introns: 0  

>19569 123 239     2q14.1    chr2:117923355-117923477 BLAT!
CAGCATCTAGAAAAATCATGATTGTATTCATACATATTACCTTTTCCCAAATGAAAGAAG
AGTAGAATGGCTATAGGGAAGGCAATTATCAGTAACCTTTGGAGAGAGAAGGAACTTTCT
ATA


invisible?    
Gene introns: 0  

>5377 143 238     16q21    chr16:66032172-66032030 BLAT!
TCAGAATCTATCACAGTGCTGGGCACTCATAAATATTGTTGAATGAATGTCTTCATAAGA
TAAACCCTGGATTAAAAAGTTCTAATGACTTTGTTCTGCTGGTGATCAGAGCATATCTCA
GAGTTCAAATCAGCTGATACTAT


invisible?    
Gene introns: 0  

>10450 130 238     4q22.1    chr4:92497998-92498127 BLAT!
GGAATACTTAACCTATATTTTCAGCACACAAAGGTAACTATGTGAGGTGATGGATATAAT
CATTGATTGCATTGTGGCAATCATTTCATAGTGTGCATGTATATCAAAACATCACATTGT
ATACCTCATA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>11655 129 238     21q22.3    chr21:48011532-48011404 BLAT!
TGTATTAGTCAATTTTTACATTGCTGATAAAGACATACCCAAGACTGGGCAAAGGAAAGA
CTGGGCAAAGGAAAGGCTTTACAAAGGGAAGAGGTTTAATGGAGAACTCAGTTTTACATG
GCTGGGGAA


invisible?    
Gene introns: 0  

>14521 100 238     Xq22.3    chrX:107191143-107191242 BLAT!
ACAATTATGTGTCTTGGGGTTGCTCTTCTCGAGGAGTGTCTTTGTGATGTTCTTTGTATT
TCCTGAATTTGAGTGTTGGCCTGCCTTGCTAGGTTGGGGA


invisible?    
Gene introns: 0  

>14719 130 238     4q12    chr4:55322748-55322619 BLAT!
AAATGATAATGCTCTTGAGCTTGGATGTATTAATTACTCAATTTTGGATAAGGAGCTCAC
AGGATAGGTTGATAGAAGCCAAATTTCTTAATTCCTTCTCCTGGTATTATCCACTTAACC
ACACAACTTT


invisible?    
Gene introns: 0  

>22253 148 238     13q33.1    chr13:103894156-103894009 BLAT!
CCACAGAGCTGGGAAGGCTGAGGGCATCACAAAGAATGAAAACAAGTCATGAGACTGTTT
CTAGGAATACCAGCCCAATAAGAACACATTCAAATCCTCAACCTCAGAGAGATGAAAGCC
AGAAACTCCATTTTAAGGAAACAAAAAA


invisible?    
Gene introns: 0  

>5295 147 237     2q21.1    chr2:131538459-131538313 BLAT!
TTAGGTAGTTCTTTATAGCAATGTGAGAATAGACTAATACAGTCCCATTTTCTCTTTCTG
CTCCTTCTGGTAATTGCATATATGTTACACTTTTTGATCTGTCTCACAGTTTGGATGCTG
TATTCTTCTCTGCTCTTCCCTGCACCC


invisible?    
Gene introns: 0  

>10246 121 237     4q21.1    chr4:78061596-78061476 BLAT!
AACTGCAGTTAATATTTAGATGTCGTCTCATTTCTGGAACAAATCAAGAGCTGCTGGCAC
TTAGTATGCCATTATTGACTTGCAAATATTTCTATTTCCATACTAGTTTGCAAGGACCAC
C


invisible?    
Gene introns: 0  

>18996 145 237     1q24.1    chr1:166753322-166753178 BLAT!
AGGAGTATGTTCTAACCCATTGCAAGAAAGCTAAAAACCTTGGAAAAAGGTTAGACGAAT
GGCTAACTAGAATAACCAGTGTAGAGAAGAGCTTAAATGACCTGATGGAGCTGAAAACCA
CAGCACAAGAACTTTGTGAAGCATA


invisible?    
Gene introns: 0  

>20678 110 237     19p13.2    chr19:8880834-8880725 BLAT!
TTAGTCATCACTGTGACATCAATTGTATTGGTGTTGATTATATCTGTATTCCTTGGGTTA
AATAAAAATGTTAAAATGAGTTTCGTCTATTTGCGTTTCTTTTCTTTAAT


invisible?    
Gene introns: 0  

>10378 151 236     Xq21.33    chrX:95810637-95810487 BLAT!
CTTCTTTAAAATGAAAGTGACTAAACTACATTTTTTTCCCCAAATTCCTTTCAATTCTAT
GATTCAGTGATCCAAAGGAGTGAATAAGAGTTTTCCATGCCAGGCGTGGTGGCTTATGCC
TGTAATCCCAGCACTTTAGGAGGCCGAGGCG


invisible?    
Gene introns: 0  

>19513 117 235     2p15    chr2:62511475-62511359 BLAT!
CTGGGCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATCCGGCCATCTCAGCCTTCCAAA
GTGCTAGGATCACAGGCATCAGCCACCACACCCAGCCTTAGGTATTCATATATTTTC


invisible?    
Gene introns: 0  

>20355 134 235     18p11.31    chr18:6651846-6651979 BLAT!
CGAAAGAACACATTAGGTAGTGTCTAAAAGATCCCTGCTCCAGTATTTTACATGCGAGAA
CATGCAACATTTTAGCAATTCACATTTTGTTATTTTGTTCCTTAGCATTTTGGAAGAAGT
TGCTATGCTTTTAG


invisible?    
Gene introns: 0  

>20653 129 235     17q24.3    chr17:69258847-69258719 BLAT!
GACTGAAAACACAGGGGTTATTGATCCTCTCAGCTGTTTGTTATTGGGTCTTTGGTCTTG
CTTTATTGTTGCATTAGAAACTCAAACACCTATTTCGTGAAGCCAGGGACAATTCACCTC
TGTGGAACC


invisible?    
Gene introns: 0  

>22180 142 235     18q12.3    chr18:39292006-39292147 BLAT!
TTACCAGCAACCAGTGGAAAAATTCCTGAGCTGAGGTTCAGATTCTCTTTCTCAGGAGCC
TTTGAGAGAGAATCAGGCAGTTAATAGGAAGAAATAAAACTGAAAGTTTGCCTAGAGAGA
ATTTGTAAAGTAAAATAGGGCC


invisible?    
Gene introns: 0  

>7291 121 234     7p12.1    chr7:52947405-52947305 BLAT!
CTATCGCTCAGGCTCGGGTTCAGTGGCATGATCTCATCTCACTGCAACCTCCATCTCCTG
GGTTCAAGCTATTCTCCCATCTCAGCCTCCCGAGTAGTTGGAACTACAGTCGCACCCCAC
C


invisible?    
Gene introns: 0  

>9393 144 234     8q11.23    chr8:54560026-54559883 BLAT!
AGCTACACATATCTGTATAAGGACATACCTATGATGGCAGACATCTTTGATTTCAGAGTG
TCAAGATGCATTCACAGTTGTGAAGTGTCATTTTTGCATACCTTGAGAAGTGTTGCATAA
ACTTCAGATAACTTGGGATCAAAA


invisible?    
Gene introns: 0  

>19648 104 234     3q13.13    chr3:110594044-110594147 BLAT!
AGGGCTATAAGGCTGGGCAATTTTACAGGACCCAACCCTACAGTGTTTGCTGCTGCGATG
ATAGTGGGAAGTGAGGAGGTCCTACCTCTTTGTTGCCACTTTCT


invisible?    
Gene introns: 0  

>20565 109 234     1q23.3    chr1:161701297-161701405 BLAT!
TCTTCAGGCATAGCTTATCTCTTTCAACGAATTGCCAGTCAGAAAATCTTTGAATCCACC
TATTACCTAGAAGTCGCCCCCTCAACCCGACTTTGAGATGTCCTGCCTT


invisible?    
Gene introns: 0  

>8188 105 233     3p26.1    chr3:5628881-5628985 BLAT!
TGTTGGTAGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGG
GATCTGGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTG


invisible?    
Gene introns: 0  

Shown 1531-1560 from 1945 sequences on 52 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs