Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 901-930 from 1945 sequences on 31 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>8206 134 496     6q22.33    chr6:129894556-129894689 BLAT!
GATATGAAGGACCTCATCAAGGACAACTACAAACCACTGCTCACAGAAATAAGAGAGGAC
ACAAACAAATGGAAAAACATCCCATGCTCACGGATAGGAAGAATCAATATCGTGAAAATG
GCCATACTGCCCAA


invisible?    
Gene introns: 0  

>12284 117 496     9p21.3    chr9:25131470-25131586 BLAT!
CTCAGCAAACTATCACAAGGACAAAAAACCAAACACCACCTGTTCTCACTCATAGGTGGG
AATCGAACAATGAGAACACATGGATACAGGAAGGGGAACACCACACACCGGGGCCTG


invisible?    
Gene introns: 0  

>22951 188 495     9q21.32    chr9:85801165-85801352 BLAT!
ACACCCAGGAGTAAGCTATTTAAAAAAGCAAAGTAATCTAAATTAGGAAACTCCTTCACT
CATCACCCAGTCCCTTGTTAGAAATGCGTCCCTACATTTCATGTTGCTTCCAGATTGATC
TTTCCAAACAGCCACTCCCTGCTCAAAATCCTTTAAATGCTCTCTGTTATTTAAATATTC
CCTGTTCT


invisible?    
Gene introns: 0  

>11196 199 494     18q11.2    chr18:23491164-23490966 BLAT!
TTCATGTAGCCAAACAGCTGAGTGAGATACCGATAGAGGCAGACTGTTAGGAAACTAAAA
GAGAGATGAAGGAGTGAGACAAACAGAATCCTGCTAAAATCACTCTCATCTTTGGATTAC
TGTGAGTATACTCAACTTTACCTTCCTTCACTTAATAATTTAAAAACACTTATATCTTCT
CTCTTTCTCTCTCTCCCAC


invisible?    
Gene introns: 0  

>21764 170 494     7q33    chr7:135525268-135525437 BLAT!
TTTTCACCATTGTCCCTTCATATCTTAATATCACAATACATGCAATTAGATGATAAATGG
TGTCTTATTATTTGATAAATAATTAAGTAAATATTACATCCTTTAGTTCCACTGTTTCCT
GACACATAAATGGATGCATCAAGTTGTCACAGAACCCCCTCCTTAATGGG


invisible?    
Gene introns: 0  

>9707 172 491     1q23.3    chr1:161700600-161700429 BLAT!
AGCCGCAGGATTAGGGTTTGCAGCCTAAGTCTGAGACACCAAACTGATCAGAGTATCAGA
GAGAAGCAGATTCCTCCCTAGGTTTCTCCAGCATTTTTCTGCCATCCCTGCTGTTTGGGA
ATGAGCTCTGAGAGTCCCCTTGGACAACCTGGGCTAGCTAGCCTTCTGGTTT


invisible?    
Gene introns: 0  

>207 130 490     10p11.21    chr10:36149226-36149355 BLAT!
CAAAGGGAAGCCCATCAGACTAACAGCAGATCTCTCGGCAGAAACTCTACAAGCCAGAAG
AGAGTGGGGGCCAATATTCAACATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATA
TCCAGCCAAA


invisible?    
Gene introns: 0  

>11431 156 490     3p13    chr3:70257032-70256877 BLAT!
AGTTGTCCCTCAGTGTCTGAGGGGAACTGGTTCCAGGACTCCACAGATATCGAAATTTTC
AGATGCTCAGGTCTCTAATATAAAATGATGTGGTATTTGCATATAACCTATGCATATCCT
CCCATATACTTTACTTGACCTTTAGATTATTTATCA


invisible?    
Gene introns: 0  

>12933 160 490     6p24.3    chr6:9681110-9680951 BLAT!
TCCAGCCTGGCGAATTCTAGTCAGACCCGTTCTCTGCTCTTGAACCCTGACAGTGCATGC
ACAGCAGGAAATGGAAGTTCATTAGTGATTCTAGTTTTGCCCTGACCTTCTGCCTTGTGA
TCTTTTGTCACCCTTGAAGCATGTGATCTCTGTGACCCAC


invisible?    
Gene introns: 0  

>22355 159 490     3q11.2    chr3:95889872-95889714 BLAT!
AGATTTTATTTCCAATCTCCTAATGAATTACAGTATGCAGAGCTTATCTGCATACTGTAA
AAGTTGTCCCACCTCAAGAGATTTGCTCAGTTAAATTTGTAATTTCTTCCCAGTTCAATT
TTAAGCCAAGCACTTTAAGGTTTGGGGAAATTAAACTTT


invisible?    
Gene introns: 0  

>24857 217 490 165004+,203249-,56114-,94117-     4q35.2    chr4:190664116-190663968 BLAT!
GGAGTGAAGTGAACTCTGGGATTTTTTGGTTGTTGTAATGTGATGGTTTTCTCAAATGCT
GGTTATGCTAGCAGTGAAATTTTCACAGGGACAGACTCAGGACCTCTGGTTAGCCAGGAT
GTTGCAGGCAGTGGAATTAGCTGTTGTTTnAGTTGTAGAAGGGGGCTACCACCTTGCCCT
ATGTTGGCCAGGATAAGTACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>3985 159 489     10p15.1    chr10:4236294-4236136 BLAT!
TATGGGAGGAGAAAAGGGAAGCTTGCTTGAGGCCAAGAGTTCAAGACCAGCCTGGGCAAC
ATGGCCAACCTCATTTCTATCAAAGAAAAAATTAAACGAAGAATTATCCAAGTGTGGTGA
TGCACACCTGTAGTCCCAGCTACTTGGGATGTGGATGTG


invisible?    
Gene introns: 0  

>5549 148 489     7p21.1    chr7:17748865-17749012 BLAT!
AAACAGCCAGGGCAGGTGAAATCTAGCCAATAATGCCTTCCTAATGAAAACTAAAAGGTC
TTGTTTGTATTTCAACATCTCTAGTTACTGCAAACCAGACCTCGAGTCTTCCCCAGTGAA
AGAGGTTGTTGACCTGGTAGTGAAGGAA


invisible?    
Gene introns: 0  

>6272 188 489     2q24.2    chr2:160952898-160952711 BLAT!
CATTCAGAGCTCACAACAACCCTATGGGGGGGGTATTATTTTTATCTCCTATTTTACAAG
TGAGGAAACTGAGGCACAGAGATGTTAAGTAAATTCCCCAGGTCATACAGCTTAACAGAC
TTCGAAGTGTCAAAGATAAACAAAGCCAGACACTAGTTAAGGTGGAAACAACAGACTTTA
ATCAGTAA


invisible?    
Gene introns: 0  

>5691 152 488     13q21.1    chr13:55756881-55757032 BLAT!
CTATAGTATTTTCAGAAGTTAGTAGAAACATAGGACATATTTCTAATAGAGTCTCCAGTA
AACTAGCTTTTAAAAGGTGTGCTTTACATAAGAGAAAAATAGTTGTCAGTGGAAATCTAA
AGGTAAAAATTTAATATTAAGTGAAGACATTA


invisible?    
Gene introns: 0  

>10213 194 488     7p11.2    chr7:57875310-57875117 BLAT!
GGGTGATGTTAAAGACCTTCAGTTTTGTAAAGGAAGCAGAGCATACGGTTTTGGAAAATT
TGCAGCCTGACAATGTGATAGAGAAGAAAATCCCATTTTCTGAGGATAAATTCAAGCTCT
CTGCAGAAATTTGCATAAGTAACAAGAAGCTGAATGTTAATCCCCAAAACAATGGGGAAA
ATGTCTACAGGACA


invisible?    
Gene introns: 0  

>10820 162 488     15q14    chr15:37954514-37954675 BLAT!
GCATTATTTATTAAATACAGAATCCTTTCCCACTAGTTGTTTTTGTAAGCTGTGTCAAAG
ATCAGATAGTTGGAGGTGTGCAGCATTACTTCTGGGCTCTCTATTCTCCTCCATTGTTCT
ATGTGTCTGTTTTTGTTCCAGTAGCATACTGTTTTGGTTACT


invisible?    
Gene introns: 0  

>18426 160 488     1q32.2    chr1:208740833-208740674 BLAT!
TTGCTGGAAGTAATCTTCACAGTCATTCGGTCCCCTCACTTCACTCCACAGAAGAGAAAA
TGGAGGTCGGGCACAGTGGCTCATGCCTGTAATCCCAGGACTTTGGAAGGCCAAGGCAGG
TAGATCACCTGAGGTCAGGAGTTTGAGACCAGCCTGGCCA


invisible?    
Gene introns: 0  

>9284 151 487     Xq13.1    chrX:70995814-70995964 BLAT!
TCAAGCAGAGAGCCAAATCGGGAACACAGTCCCATTCATAATTGCTACACACACCAAGAT
ACCCAGGAATACACCACACCAGGGAGGTGAAAGATCTCTACAAGAAGAACTACAAAATAC
TGCTCAAGGAAATCAGAGACGTGACAAACAA


invisible?    
Gene introns: 0  

>14898 195 487     2p12    chr2:81890054-81889860 BLAT!
AGTGCCTTTCCTTGGGGGCGGGGCAGCAGAACAGCAGACAGGACTTGCCAAAGCCTTGCT
GCTCTAGCCAAATACTTCCTTCACTGTATGTCTGAGCAAACTACAAACACAGAGACATTT
GGTTGAGATCTAAGCACCTATCATTTACAAAAGACCAAAATTGCAAACACAAAGTAGGAT
ATATGTTTAAGGACC


invisible?    
Gene introns: 0  

>18068 162 487     1q32.1    chr1:200832673-200832512 BLAT!
CCTACCTAGCCCCTTTCATCTAATAACTGTTTCCTAGATAATTCTGATTAACCTATTATC
AGAATTTGTTTTCACCACTTTTGCAGTTTCTCCATTCTCTCATCTTTATGAATCTAGATA
TTAAACAGCAGGTGAGCGTAACAGGCTGATTTTAGCTGTTGT


invisible?    
Gene introns: 0  

>5389 127 485     2p24.2    chr2:17109202-17109328 BLAT!
TCAATAAATACAGAAAAAAGGTTGCTCCATTGATCCATTTTTGACACAAACTTTCTTCTA
AGTGGGAATAGAAGCATACTTCCTCAATTTAATAAAGACAATAAAATAAAATAAAAAATT
ACAGCTA


invisible?    
Gene introns: 0  

>5666 153 485     6p25.3    chr6:1252894-1253011 BLAT!
GACACCTTGTCCCTCTGCTTCTCATCTTCAGCTTTGTACAGAAAGAAGGCACTCTGTATT
TTTGTGAAGAGATAAACAATAAAAGAAGGATAAAAAGAAACACACAGTAGAAATAATGGA
AACTTTCTCAAATTAGTATGATATTTGGAGTAT


invisible?    
Gene introns: 0  

>9217 158 485     18q12.1    chr18:26418173-26418016 BLAT!
CCTAGATTTCAGAGGATGTATGGAAATGTCTGGATGTCCAAATAGAAATGTGCTGCAGCA
GCTGAGCCCTCATGTAGAACCTCTATTAGGGCAGGACAGATGGGAAAGGTGGGGTTGGAG
CCCTGATGCAGTCTCCACTGGGGCACTGAATAGTGGAG


invisible?    
Gene introns: 0  

>17928 166 485     4q13.1    chr4:61161453-61161618 BLAT!
TGCCCAGGCTGGTCTCAAACTCCTGGGCTCAAGCAATCTTCCTGTCTTGGTCTCCCAAAG
TGCTGGAATTACAGGCATGAGCCACTCCTGACCTGCCTCTTCTTTACATGAATGTATTAC
TGAGACGAATAGTATGTCTCACTAGTAAACCCTTCCTTTGCCTAGT


invisible?    
Gene introns: 0  

>12831 179 483     12p13.1    chr12:14390400-14390578 BLAT!
GCAATTATCCTAGTATTGGATCATCTTTGTCTCCTATCACTATCATTTTCTTTCCTATTG
CTTTCATTTTTATCTCTTTTCTTAGACATGGTTTAAACATTAATCACGTTTTAACTTACT
TAACACTTGTAACAAGCCTGAGTTAAGTGCTATCATTATTCTCATTGTTTTGGTCGGGA


invisible?    
Gene introns: 0  

>19339 214 483     8q11.1    chr8:46979205-46979314 BLAT!
GTCTATGGGGAAAAATCGAATACACCCAGGTAAAAAATAAAAACTGCCTGTGAAACTGCT
TTGTAATGTGTGGAGTCATCTCACAGTGTTAAATTTTTCTTCTTATTCAGCAGGTTGGAA
ACACTCTTATTGCAGAATCTGCTAAGGGACATTTGTGAGCCCTTTGAGGCCAATAAAAAA
TGAATATCTCCAGGTAGAAACTAGAAAGAAGCTA


invisible?    
Gene introns: 0  

>2980 186 482     17q25.3    chr17:75975120-75975305 BLAT!
TAAGGTTACCCACAGGAGATCTAGATATTAGGGTTATCAGACATGGACCTTAAGGTAATG
TTGATAAATATGTTTAGTAAATTAAGTGACAAATGGAGGATTTCAGAAAGAACTGGACAC
TATTAAAAAAGTTAAATGGAAATTCTGGAATTGAAAAGTGCAATATAGGGTGACAATAGT
TTACAA


invisible?    
Gene introns: 0  

>13860 204 482     1q25.3    chr1:185763887-185764090 BLAT!
AGGATCAATACTTTGCATCCTTCAATCCAATCAAGTTGACATTCAGTATTAACCATCACA
ACATTGATTTAAAAAAACTTGTGATAATATTCCCAAAATATGACTTTTGTAAAAAAAATG
AAAGTAGTGCCACTATATTTATATATTCTCTGTATATTTGGGGTAGAAATTTTTAGATTA
GAACTTTAACTTTTGGAATATTTA


invisible?    
Gene introns: HMCN1 (185703682 - 186160085)  

>18307 154 480     14q22.1    chr14:52755799-52755935 BLAT!
GTATGAAGAACCTGAAGTCCTGGGCTAGTGTAAATCGAGGTGCCATTATTCTTTCTAGCC
TCCTCCAGAGTTGTGACCTGGAAGTTGCAAACAAAGTCAAAGCTGCACTGAAAAGCTTGA
TTCCTACATTGGAAAAAACCAAAAGCACCAGCAA


invisible?    
Gene introns: 0  

Shown 901-930 from 1945 sequences on 31 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs