Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1411-1440 from 1945 sequences on 48 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>13403 128 271     7p12.3    chr7:48279481-48279608 BLAT!
GTCTGTCTTTATAGGGATGTTGGTGTGGGGCAGAGGGCCTGAGTGATTAGATTGCTCCTG
GCCTCAGAAGCTCATGGAGCCCTGGCTGTTTCACAGCTTTGCGCTTCTTGGGGAGGTTTT
GGAGACTG


invisible?    
Gene introns: ABCA13 (48211056 - 48687091)  

>3302 124 270     7q31.1    chr7:112637489-112637366 BLAT!
ATAATGTATCTGATTTATAGAACATTCAGTTTCAAATGCATTGTAAATTAAATAAAGTTG
GCAGGCTAGCTGGAGACCATAACCACCACTTACGGAGTGTCTCATGTGGGAAAATGTGTT
CTTA


invisible?    
Gene introns: 0  

>18009 113 270     1q23.3    chr1:161673988-161674098 BLAT!
GGGTGGATCACGAGGTCAGGAGTTCAAGACCAGCCTAGCCAACATAGTGAAACCCCTGTC
TCTACTAAAAATACAAAAGTTAGCCGGGCATGGTGGCGCACGCCTGTAGTCCC


invisible?    
Gene introns: 0  

>3060 111 269     7p14.3    chr7:31190747-31190857 BLAT!
ATATATAATATGGTAATGAGCATCTTTGTTAAAATGTATGCATTTGGTTCCTATGAATTA
CTCTAATGCTTAATGGTTATTTGATAAGATTTGATGTAAATAAAGCAAGCA


invisible?    
Gene introns: 0  

>3546 171 269     16q12.2    chr16:52922606-52922776 BLAT!
CCCACTCCTGGTCTAGATGAATGTTGATGAGAGAATGGAGGGCACCATGTTTGATACTCA
CTCTGAGGTCATCTAATGGAACTGGATGGATCCCCCAAGGAAAATCATGGTGCTCCAACC
AAGAAAATAGGAATGGGTGTCTACCCTGAGAGAGCAAGAGTGGATATGAAG


invisible?    
Gene introns: 0  

>5056 115 269     16q12.1    chr16:50556559-50556445 BLAT!
TCAGACTGAGTAGCTAGAAATGAAGTATTACTATTATAATGATGACAAGGTGCTTAGGGT
TAACATCACCGGCTTTGGGAGCCCAACTGCTTGAACTCAAATATTCACAGCTCTG


invisible?    
Gene introns: 0  

>5646 155 269     18p11.23    chr18:8413049-8413171 BLAT!
AGTGCCTCAATTTGAAGCTCCTTCTCCATCACACAGTAGTATTATTGATTCCACAGAATA
CAGCCAACCTCCAGGTTTCAGTGGCAGTTCTCAGACAAAGAAACAGCCTTGGTATAATAG
CACGTTAGCATCAAGACGAAAACGACTTACTGCTC


invisible?    
Gene introns: 0  

>5977 138 269     16p12.1    chr16:24265099-24265236 BLAT!
GCTGTTCCACTGTGGGTCTGGTAAATGGAGAGATTGGGGCATACTGTCCCTTAGCCCGAA
GCTCACTCACCTTTCATCAACATGGTCCTTCTTTGAAAGAAGACCTTTCTCACTTCTATC
CAAGCAAGAGAAGAATCA


invisible?    
Gene introns: 0  

>17601 143 269     1q43    chr1:237362326-237362468 BLAT!
TGATCAATTTGATAAATGCAAACTTCAAAGGTGGTTCCTTGCCGGGGTCCTGCAGAGTGT
GTGAAACAAAAGTGAGATATGGTTTTTGCCTTCAAGGAAATTTTGCTATCAGGATAGAGG
TGCGACATTCTGTATTAGTCAGA


invisible?    
Gene introns: RYR2 (237205701 - 237997288)  

>19930 166 269     8q12.3    chr8:62629790-62629626 BLAT!
AGTCAAGAATTGAGGTTTGGGACCCTCTGCCTAGATTTCAGAAGATGTATGGAAACGCCT
GGATGCCCAGGCAAAAGTTCGCTGCAGGGGCAGGGCTTTCATGGAGAACCTCTTCTAGGG
CAGTGCAGAAGGGAAATATGGGGTTGGAGCCCCCACACAAGAGTCC


invisible?    
Gene introns: 0  

>20221 105 269     5p15.1    chr5:16231927-16232031 BLAT!
CCCATCTCTTCCTAATCAGAATAGCCCTAATAGGCAGTCCTAGATCTAGTGGTTTTTTTT
AAAACCAAGAGAATATGGAATGAGAACCAGATGGTAAATTTGAGC


invisible?    
Gene introns: 0  

>21719 126 269     8q24.13    chr8:126884607-126884732 BLAT!
ATCTTTGTGTAATCTCTGCTACATATTTTTTATTTGTTTTTCCTGTGTCTGTTCTAGGCA
GATGATTCTTCTCATACTTGTTTAATCTCCCTTGATCCTTTACTTTCCAACTTGTTTGCC
CTCTTT


invisible?    
Gene introns: 0  

>3346 136 268     1p33    chr1:48494812-48494683 BLAT!
GAGGCGGAGGTTGCAGTGAGCCGAGATCGCACTGCACTCCAGCCTGGGTGACAAGAGTGA
AATTCCATCTTAAAAAAAAAAAATCCAAAAGAGACAGATTTGAGATAAATTTTAAAGTTA
CAATAGCCTGGGGTTT


invisible?    
Gene introns: 0  

>3355 134 268     13q31.2    chr13:89166448-89166581 BLAT!
TGAGGAATTATGTCTGACAGAAGGGAAGAAATGACTGCGATGGCCTTCTCAGACCCTGTA
GGAAAGGACTTTACTTATTCAGTGAAAGTGTCTACTTAGACTAAGAGGTATTTTAGTTTC
CTGACTCGGGCATG


invisible?    
Gene introns: 0  

>12014 165 268     13q33.2    chr13:106813633-106813796 BLAT!
GTAATGAGCAGTCTTGCTGGTTCAAAGATATTTAATTCTATAATTTTTTTTTTTCTGAAA
ATGTAAGTGAAGGGCTTTTAGCATTAGTGACACGACTTGCCGCTGTGGAAACCTGCCCGA
AATCAGCCTGGCCTACTTTCATTGCTATATCAGGCAAGTTAAGAA


invisible?    
Gene introns: 0  

>21202 135 268     4q21.21    chr4:82346976-82347110 BLAT!
TTCTCTGGGGAAATTGAATAATATAAAGCTTTCAGTGGCACTGGCCTCTGTGTGTCATCA
CTCAGCTACCCCCATAAATTAAAATCTCAACAGGTATCATGAGGCAGAAGTGTCTTCCTA
CTCTGAGCGGGATCC


invisible?    
Gene introns: 0  

>6292 127 267     6p22.3    chr6:22520255-22520129 BLAT!
TGACAGAGTTCTCATGTCCATTCTGTTTTGTTATTACATAGGTCAAACCTCTCCCAACCC
CCACCACTTCCATTGCCTTTATCACTTGCTATTTTTCAAAATCAACTTGGTTGTTCTTGC
CTGTTTT


invisible?    
Gene introns: 0  

>16856 108 267     8q21.11    chr8:75019943-75020050 BLAT!
TGGCAAATGATAAAATTGGAGAGAAAGAACTAGACTTAGGATTCAATCATCCAGGCTCTA
CTCTGGACTCTCTACTTATTTTTTGTTTGGCTTTGGAAAAGTTACTTC


invisible?    
Gene introns: 0  

>18060 130 267     11q13.3    chr11:69273671-69273542 BLAT!
GGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGCAGGTGGATCATTTGAGGGCA
GGAGTTTGAGACCAGCCTTGACAACATGGAGAAACCCCGTTTCTACTAAAAATATAAAAA
TTAGCCAGGC


invisible?    
Gene introns: 0  

>20038 148 267     4p14    chr4:35953904-35953757 BLAT!
TGGCATGAGACATGTTTCTTGTTGTTGTCGTTTTTGTTTTAACTGAAAGCCAGACATGTT
ATCTGGCAATAGGAACTGAGATAAATAGGCTTAAACTTGAGAATTTATGTTAATGTAGTA
AGAAGCTGGGCTGTGTTTAGTGTTTGCT


invisible?    
Gene introns: 0  

>4953 111 266     14q12    chr14:25166655-25166545 BLAT!
CTCACTCATCTTCCACTCACTCACTCCTCCACTCACTCACTCCTCCAGTTACTCATTCCT
CCACTCACTCACCTTCCACTCACTCACCTTCCACTCACTCACTCCCCCACT


invisible?    
Gene introns: 0  

>11125 113 266     10q21.1    chr10:55416100-55416212 BLAT!
ATGAGTTGAATTGTATTGCCTAAAAATTGGTATGTTGAAGACTTAACTCCCAGCACCTTA
GAATATGACTATGTTTAAAGATTAGATCTTTAAAGAATTAATTAAATGACTGG


invisible?    
Gene introns: 0  

>16462 149 266     11p14.1    chr11:28616230-28616082 BLAT!
CTTGACTGTGGAAGAAGCCACTTCCAAGCTCATTCATATTGTTGACACAATGCATTTGTA
TTGACTATAGGATTCAGGGTAGCTTTCTTCTTCAAAGCCAGGAAGGGCCTTTGAAGACAA
AGAGATGAGTTTGCTAGTAAGATGAAATC


invisible?    
Gene introns: 0  

>17081 147 266     3p14.1    chr3:67978168-67978109 BLAT!
TTGGTAGATTCTGAGGTCTGCATATGGATCCCAGAAATGATCCTAGCTTGACATCGGAAG
GATAAAACGCGGTCCTGTTCCTCAACGGGGAATTCCAGTATCACAAAATTCTGGTCTCGA
GAATTCTTCTCTCTTTTCAGCTTGACC


invisible?    
Gene introns: 0  

>22561 130 266     16q21    chr16:63671539-63671410 BLAT!
CAAGCAATTTCTTTACTAGGATTCCTTATTTTACTCTTTTATAGACATTCCCACATCCCT
CTATGTCCCCACATCCATCACTGACAACTGCTATGCTCTCATCTTCACTCCTATGTTTGT
CATTAAAATT


invisible?    
Gene introns: 0  

>7676 141 265     8q21.3    chr8:90498034-90498174 BLAT!
GATCTACTGAATTATAACGTGCATTCTAAATAAGACTAGCAGATGAATTATAAACACGAC
AAGGATGGTGGGTGATATCCTTTGTCTGTGTCCTCACCCAAATCTCAACTTGAATTGTAG
TTCCCATAATCCCCACGTGAC


invisible?    
Gene introns: 0  

>10278 135 265     7p15.2    chr7:27471641-27471775 BLAT!
CAGATGACTTGTCTGTCACTACAGCCCAGCACTTACTGATCATCTCTTTTTGACTCCCTG
GGACTTTCACCACAGCAGCAGTGGTTTAAAATTTTCTCCACTCAGGCCTCACCCGACCCT
CCTCCACCTCTTCAC


invisible?    
Gene introns: 0  

>11517 118 265     13q31.2    chr13:88908532-88908653 BLAT!
TGAGAATAGTGAAAATATATTTTCATCTAGTCTTGCTATATTGTCTTTTAGATTTCTGTT
TTGCTAGAATAGTCGCTCCGATGTTTTTTAGGGAGGGAATTTTGAAGTATAAAACCTA


invisible?    
Gene introns: 0  

>11534 123 265     12q13.13    chr12:54316039-54315917 BLAT!
CCAAGTGCCCAGAAAATTAGAGGATGACCACAATTGTCTACAAAATGTCCAAACAATGTT
TCAGTTCTGTTTTCTAATGACAAAACTCCAAATATGATTTTTGACATTGTAAGGACTAAG
GAG


invisible?    
Gene introns: 0  

>11631 136 265     5p13.3    chr5:30887296-30887161 BLAT!
GATTTGGGTTAGAAAGGGGGGTTCAGAAGTCATCATATGCTATTGCTATTACTACTAATA
CTATTAGAAATGACAGCAGCAACAATCATAGGTTATGATGACCTAAAAGTGATAGAAAAG
AGAATATTTCAAAAAC


invisible?    
Gene introns: 0  

Shown 1411-1440 from 1945 sequences on 48 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs