Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 631-660 from 1945 sequences on 22 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>8565 175 736     3q13.33    chr3:120525588-120525417 BLAT!
TGCTGCTTGCACTCTGCTGGGTTTTGATCCTTCTTTGGGTCATAGTCTGGATCATTTTCC
TCATCTCCTTCTTCTTCCCCTTCCTCATCCGCTTCTTCACCTTCTTCATCATAATCATCA
TCATCATCTTCAATAGCTTCTCCAGTAAAATATAACACTGATCTTGGGATTATAC


invisible?    
Gene introns: 0  

>6418 208 734     10p12.1    chr10:25737319-25737526 BLAT!
GTATCTGACTTCTTTAGTAGATAGTTTTGAGATTAATCTCTGTCTGTTGTGTGCATCACT
TTTTCCTTTCTATTTCCAAGGAGTATTTACTTTATGAATGTTATGTAATTTGTGCCTCTC
TTTGCCTGTTGGATAGATATTTGTGTTGTTTCCATTTTTGGCTATTAAAAATAAAGTTGC
TATAAACAGTCTTGTGCTAGTCTGTGTT


invisible?    
Gene introns: GPR158 (25464289 - 25891157)  

>7633 211 734     9q31.2    chr9:110736965-110736755 BLAT!
AGGGAGACCAAGATTTCCACCTTCAAAATGTCTAGTTTGAGACACTCAAGTAGAGAAGAC
ATAAAGTTCATATACGAGTTTTGAGTCCAGTAAGAGGAGATCAGAAGTGTGATTATGCAA
GTAGGAATCATTTGTATGAGGACAGAATTTAAAGCTATGAGAGTAGATGTGATTCCTAGG
GGGAGCATATAGTTGAAGAAGAGAGAAAGTC


invisible?    
Gene introns: 0  

>13606 197 733     3p23    chr3:31494403-31494592 BLAT!
TTCATTTTCGAAGTCTCGGTCCCGAAGCCGATCTCTCTCTCGTTCAAGGAAGCGCAGGCT
GAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAAAGAAACCACCC
AAGAGTATATCAGAATCGGGATTTCCGAGGTCACAACAGAGGCTATAGAAGGCCCTATTA
TTTCCGTGGGCGTAACA


invisible?    
Gene introns: 0  

>10516 189 732     22q11.22    chr22:23330673-23330487 BLAT!
TTGAGCTTAAAAAGCTCCCTCTCCAGCTCTTGCTGATACTCTGAACTAGCATCAACAGGT
CCTCCAGATGTCTGTCGCTTAGATTTGTATTCTCTAATCTTGTCCACAAAGAGTTTCTGT
ATAGGATCAAGTTCCTTATTAAATGCCACTGCTGTAACACCAATGTTCCTCCGCAAATGG
ACTGAGACG


invisible?    
Gene introns: 0  

>12208 199 732     10q21.1    chr10:60603500-60603698 BLAT!
TTTGGGGGTGATTATGCTCCTTACATAAGTTCGCATTTGAGGACAAATTTGAGTGGTCCT
AGAGGAAAGATGTTTAGGGATATGGCAATAAAGCATTTACACAATATATTGGTGACCACA
GTAAGAAAGAGTGATATAACATTACAAGCAGCAGAGGCGCTAAATCCCCAGTGTTTAAAG
CGGTTGTTGTGGCTCCTTT


invisible?    
Gene introns: 0  

>20003 199 727     19q13.2    chr19:42012324-42012495 BLAT!
AGCGGCCGCCCGGGCAGGTACGCGGGGGAGTGAGAGAGGTATGAAGGTTATTGAAAACCG
GGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCA
CATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGA
AGGAGACTTGGAACGCACA


invisible?    
Gene introns: 0  

>5342 184 726     5p13.3    chr5:30558081-30558264 BLAT!
AATAAATAAATTTAAATTTTAAAAAATCTAGTATGAAGCAGATTTTATTTCCTCACGCAT
AGCCTTTTCCTATTTTATAATCATATCACTTCTTTACTATCACATTATCAAAATAATTTT
TCTGAAACAAAGGAAACTTCCAAAAATTAATTCAAACCTCTATCTCTAATGAAATATTCA
TTTT


invisible?    
Gene introns: 0  

>17483 187 726     3q24    chr3:148687536-148687722 BLAT!
TTGATTGTTACCTTCAACACATACATATACTAGTTTAAGCTTATGTTTGTTCTGAACCTT
AAATCTGAATCTTTTTATAAATACATTTTTTCCAAGGCCTATTTTGAAACTTCTGAAGTA
GAGAGAAGTAACATTGGCCCCCTTATTAAGATTTTAGAAAAGAAACTAACATATTCTTAT
TCATGTT


invisible?    
Gene introns: 0  

>9576 203 724     5q13.1    chr5:67631189-67631391 BLAT!
TGACATCAGTGAGAGATTCAAAGGGTCATGCAGCCTTTGGGTTCAAGTATATCCAAGGAT
TCAAATGAGGTCAACAGGATTCTGTTTTCTTTATCCCTTGGTTCTGCTTGCTTCTGAATG
GCTTCATTTTCAGATAGGCCCTCTCCTCACGGAGGCAAGATGGCCACTGGAAGTTCCACG
CTCAAAATGTCTTTACTGCTTGC


invisible?    
Gene introns: 0  

>15786 237 723     7p14.1    chr7:42835166-42835402 BLAT!
ATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGCCT
GCAAAAAACAAAAATGAAGCTTGGTGTATAGGTGGTCATTACAGACCCTGAAAAACTGGA
CCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAAC
TGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTT


invisible?    
Gene introns: 0  

>22298 174 720     4q28.3    chr4:138337169-138337342 BLAT!
GCCCAATCATCTCAACGGACACTAAGGAACTCAGTTCTACTAGCAGTTACCTCTCCAACT
CTTAGTCTCTCTCTGCAGAAGAAATAAAATTCACATGGCGTTAGTGCTCCTTTTAACAGC
TCATTTCTCATATATCCTCTGGTCCCTCATGCCCAGCTGATCTTCACATAATCT


invisible?    
Gene introns: 0  

>23748 257 717 45357+,203082+,110467+     2p23.1    chr2:31512411-31512582 BLAT!
CTTCCAGCTTGTCTTCATTCTTCCCTCCTCCTCTTTAGATACCATCAACTGGTCACCAAA
TTCAGGCCACATGTCAAAGGCACCAAGACCTGTGCTAGGTTCTTTCCCATGTAGTTACTC
TTGCATTTGTTCTATTTCCCCTGCTGCACCTGCCCTAAAATAAAGCATCAGGnACCTCTC
CCCAAAGGATAGCAGTGGCCTCCTGGTCTGCATACTCCTTTGTACCTCGGCCGACCTCGG
CCGCGACCACGCTATAG


invisible?    
Gene introns: 0  

>21733 246 716     15q12    chr15:27812327-27812572 BLAT!
CACACCCAGCTAATTTTGTATTTTTAGTAGACATGGGATTTCACCATGTTGCCCAGGCTG
GTCTAGAACTCCTAACCTCCAGTTATCAGCCCACCTTGGCCTCCCAAAGTGCTGGGATTC
TGGGCGTGAGCCACCACACCAAGCCTAAAATGCATTTTGAAACTAAGCTACTTGATTATG
ATATCACCGTGGATAATTAAAGTCATTTTATCTTGATAAAGGAATCAGTTCATCAAGTGG
ACAAAA


invisible?    
Gene introns: 0  

>20578 236 712     10q11.22    chr10:48472476-48472241 BLAT!
CATCTCTTCTCACATTGACCGTCACAGGATAAATGATTTCCTCACTCTTCCCAAGGGTCT
GGCCCCATGACAGAGAGGCACAAGTGCCACATGTGTCCCATTTACTGATCACGGAGACAC
TGGCAATCCTGTGTCAGGATGATGAGATGACTTGCACCTGGCAGGACTTGGCAAACATCT
CTGTGTTTCTCCATCATCACTACTATTTTTCTGTTATCACCACCAAAAGAGGATGT


invisible?    
Gene introns: 0  

>11193 178 711     1p31.1    chr1:73089512-73089335 BLAT!
AAATAATTATTAACTAGAGATTGAAGAATTCAGAAGACAAATTGGGAACAACACCACGGG
GTCAGTGAGGTAACATCTGCAGGGAGCAGCACTAGCCATGGAAGAGTTCTAAATTACTAG
AACTTAGTGACTTGGAGCAGGGCTTCTCTGGAGCTGAAATTCAGACCTGTGACTGGCG


invisible?    
Gene introns: 0  

>12118 144 711     6q14.1    chr6:77967097-77967240 BLAT!
GAAACCATCATTCTCAGCAAACTATCGCAAGGACAAAAAGCCAAACACTGCATGTTCTCA
TTCATAGGTGGGAATTGAACAATGTAAACACTTGGACACAGGGTGGGGAACATCACACAC
TGGGGCCTATCATGGGGTGAGGGG


invisible?    
Gene introns: 0  

>1151 202 710     2q36.3    chr2:229064378-229064177 BLAT!
ATCCCATTACTGGGTATATACCCAAAGGATTATAAATCATGCTGCTATAAAGACACATAC
ACACGTATGTTTATTGCGGCACTATTCACAATAGCAAAGACTTGGAACCAACCCAAATGT
CCAATAATGATAGACTGGATTAAGAAAATGTGGCACCTATACACCATGGAATACTATGCA
GCCATAAAAAATGATGAGTTCA


invisible?    
Gene introns: 0  

>4906 185 707     7p12.1    chr7:52508758-52508574 BLAT!
AATAGTAATGAAACATTTTAAACAGAAGGAAAATTATACCAAATAGCAGGTTATAGATGC
AGTCTGAAATGAAGAACAAATAAAACGTTAAATATGCTACAAATTGAGAGGATAAAACAG
TAAACGTAATATCTTGTGGAGTTACATAAGTATATAACTTTAACAGAACTAAGAAATAAA
TCCAT


invisible?    
Gene introns: 0  

>5598 170 707     14q31.3    chr14:85441483-85441314 BLAT!
ATTACATAGATCAAGGAAATTCCAAATGCTGACAATGTTCCATTGCATATTTTGAACTAA
TTCATTGAGCTGACTATATTGTGTCCTCTGCCCATGCTTTGCCTTCTGATCAGGTATTCC
CAAACAGGCTGCATATTTTGATAGATGAACTGCACTGAAAGGGGTCATGG


invisible?    
Gene introns: 0  

>14410 152 707     Yp11.2    chrY:10001488-10001639 BLAT!
CTGAGACTAGGACTGCAACCCCTGCCTTTTTTATTTTCCATTTGCTTGGTAGATGTTCCT
CCATCCTTTTATGTTGAGCCTGTGTGTGTCTCTGCACATAAGATGGGTTTCCCGAATACA
GCACACTGATGGATCTTGACTCTTTATCCAAT


invisible?    
Gene introns: 0  

>16767 157 707     16q21    chr16:64700888-64700732 BLAT!
TTAAAGCTGTGAAAAACTCCTAAACCTGACCATGGTTCTATTCATTTTAGGTTAGTTCAT
GGTCACAAATCTGTTAGAACTCTATGTGCTGTGGAAAAATATTATAAATCCAGAATCTGT
CTTCTTGTTTGGAAAGGTGAACTCCCAGTTATTATGA


invisible?    
Gene introns: 0  

>21782 186 706     10q23.33    chr10:95782162-95781977 BLAT!
TATGTATATATGCATATCTTCTTTAATTTACCTAAGCAATGTTTTTTATTTATCTGTATA
GAGGTCTACACATCTTTTGTTAAGTATGTTCCTAAATATTTTATGTTAGTGGTGGTCTTG
TAAATAAAATTATCTTAAATGTTATTTTTCAGTTGGTTGTTGCTAATACACAGAAATACA
ATTGTT


invisible?    
Gene introns: PLCE1 (95753745 - 96088148)  

>7184 182 705     4p15.1    chr4:29867501-29867320 BLAT!
CCGCCCTTAAGCTTCTGGTAAGTATCATTCTGCACTCTGCTTTTATGAGTTCAGTTTTTT
AAGATTCCACATATAAATAAGATCAGGCATTATTTGTCTTTCTGTGCCTGGCTTATTGTC
CTTAACATAATGTCTTTCGTGTATATTCATGTTGTTGAAAATGAAAAGGTTTTCCTCTTT
TT


invisible?    
Gene introns: 0  

>19595 183 704     10p14    chr10:9276569-9276751 BLAT!
ACATTTTCATGGTGTTTAATGAAAAATGGCTAAAGCATACCTCCTTTATTTTTAAGTGGA
TTAAAAACATTTCTGCAAAGTCTTGTCTTCCAAAATATGGAGAAAAAATAAGAAAGGAAA
TATCTCCTCAGGGAAAGCTAACTACTGTTTTAGTTAATAGTTTGCTTTAACTTAGAAAAA
CTT


invisible?    
Gene introns: 0  

>2098 214 700 32564+,80198+,49574-     15q13.2    chr15:31067762-31067614 BLAT!
AGACTGCTTTGCTAGCAATGAGCGAGGCTCTGTGGGCATAGGACCCTCTGAGCCATGCAT
GGGATATAATCTCCTGGTGTGCCATTTGCTAAGACCATTGGAAAAGCACAGTATTTGGGT
GGGAGTGTCCTGGTTTTCCAGGTGCCATCNNNNNNNNNNNNNNNCCCATTGTCTGACAAT
CCCCAGTGAGATGAACCCGGTACCTGCCCGGGCG


invisible?    
Gene introns: 0  

>8394 180 699     2q36.3    chr2:230630003-230630182 BLAT!
GATTACCAAGCAAATGAATTTAAGGCATAACTGGAGTAACAGCAAATGAAGTATATACTT
TTTCCCTCTGGTGCAATAAGGCCTCTGCCAAGAGAGATTACTTTAAGAGTTTTCCTGCCC
CAAATTAACCAAAGGTCCCGTGTATTGAAGGAGGAATAAGCTAAAGGCTGAGGCTTTTAA


invisible?    
Gene introns: 0  

>8567 121 699     18p11.22    chr18:9093005-9093125 BLAT!
CTCAGATGAAATGCTGGTTAGAACAGGAAGTTCACTAGTTCAACCATTGTGGAAGACAGT
GTGGCGATTCCTCAAGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACT
G


invisible?    
Gene introns: 0  

>20045 167 699     12p13.2    chr12:10741144-10740978 BLAT!
ACCTTGACATTTTAAAAATTAACTTTATTGAGTTATACTTTTCATGCAATAAAATGCACT
CACTTTAAGTCGTGAGGAATATGGGTTTTAACATATATATATACACACACACACACACAT
ATATATCTTACACAGTATGAAATCAAGATATAGAATATTTTCATCAT


invisible?    
Gene introns: KLRAP1 (10741076 - 10752434)  

>24890 224 698 168287+,204248+,198250+     4p15.1    chr4:29868009-29867849 BLAT!
CGCGGCCGAGGTACTTTGAAAGCTAGACACCAAGTCTAGTGCTTCCCTCGGTGCGATGGG
GGnTTATTTGTTTATTGAATCATTTATTTATATCATGATGGATTCTTGTTTTTATATCAG
TTATGATCCAACAATACTTTTCTTGCTCAGATTTCTCAAATTTTAGTCATTGAGAAGTCT
TTCAATTTTGCTCCTATGTCCCTTTGACATGCACTTTTTTTAAC


invisible?    
Gene introns: 0  

Shown 631-660 from 1945 sequences on 22 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs