Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 3001-3030 from 3142 sequences on 101 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>13810 112 166     4p16.1    chr4:8988296-8988407 BLAT!
GCCGAGATCATGCCACTGCACTCCAGCCTGGGTGACAGAGAAAGACTCTGTCTCCAAAAC
AAGAAAATTAAACACGGTATGATTCCACTTATCTATCAAGTGTCTAGAGTAG


invisible?    
Gene introns: 0  

>20039 113 166     Un_gl0002450    chrUn_gl000245:27101-27213 BLAT!
AGATAAAGTAATTCTTGAGAAAAGAAAGATTTATTCAGATAAAAGAAAGCTTCAAACAAT
TGTCATTAGCAGACCAAGATACAAGAAATGCAAACGGAAATTTTTTAGGCTAA


invisible?    
Gene introns: 0  

>22653 110 166     13q21.31    chr13:64708782-64708673 BLAT!
ACTAAACATGTCATCAAAACAAAAAGTCAACAAAGAAACAATGAATTTAAACTATACCCT
GGGACAAATGGACTTAAAAAATATTTACAGAACTTTCTACCCAACAATCG


invisible?    
Gene introns: 0  

>23026 112 166     12q23.2    chr12:103402418-103402529 BLAT!
GCTGCCTTCTTTCTTTGGCTTGCGGCCCCTACTTCCACCTTCGAAGTATCTTAGTCAACC
TCACTTTTATTGTCATATCTGCTTCTTCCATACAGACCCGCCTGCTCGTCTA


invisible?    
Gene introns: 0  

>23994 120 166     Yp11.2    chrY:8399766-8399647 BLAT!
GTTTGTGGCTATGGTAAGCCTGAAAAGGGTGTCTAGTAGTGCTGTTCAGTGGCACTGAGG
AGTCCCCATAAAAGCAAATAAAAATCAAAGTTTGCCTGAGAGAATGAGCCGCCTTGTGCT


invisible?    
Gene introns: 0  

>29538 112 166     16p12.1    chr16:26469501-26469612 BLAT!
TAAAAACATCAAAAATACAATTGTATTGTTTTAAGGCTCTAAAATTTGTAGTGTTTTAAA
TTATTGACCCATAATATAAACAATTTAATTGACACATTAGTAGAGTCATGGT


invisible?    
Gene introns: 0  

>32779 107 166     8q24.21    chr8:127758629-127758735 BLAT!
CTATGAAACTAGTAGAAGAAATACAGGAGTAAAACTCCTTGACATTTTTCTGGGAAATGA
TTTCTTGTATATGACTCCCAAAGCACAGGCAACAAAAACAAAACTAG


invisible?    
Gene introns: 0  

>32886 116 166     1p31.1    chr1:80252460-80252575 BLAT!
TCCCACATAAATCCTAAGGTTCACTCTGTCAATTTCTGAAGCCAACACTCTGACTGAAGA
ATTTTCATGCTCTGATTTGCTGGGGAAACCAAATGTAAATGTTGTTTTAAGTTAAC


invisible?    
Gene introns: 0  

>5804 119 165     6q14.1    chr6:78103865-78103983 BLAT!
AGCTTTAAAAAGGCCTACTTGTGTTTCTGTCAGTTTTTGACTTATTTTTCAGAAATATGA
TCTTAATGTGATCAGCACATTCTGCTTTTCCTTTTACCCAATGTAGTGTTCTATCAAGG


invisible?    
Gene introns: 0  

>5811 109 165     8q21.3    chr8:90220959-90220851 BLAT!
GCAGAGGTGCAAATAATCAGATCTCTCTCATCAATTTGGGACAACTCCAAAGCTTCCTAC
TTCTCTGCTTTGTCACTCCTTCCTAGGTGTTTTTCTCCAGTGAATTACC


invisible?    
Gene introns: 0  

>18362 120 165     4q27    chr4:123458190-123458309 BLAT!
CAATTTATCTACTCTGTGTTTTCCAGGAGTATAATGTTTAAACCATACTCAACAAGTAAG
AATCCATATTATGTTATTTTGTATTTATTTATTTTTAAAGACCTTAACTGGCTTTATTTA


invisible?    
Gene introns: 0  

>24097 109 165     22q12.1    chr22:27389525-27389633 BLAT!
TGGAAGGTGGAGGCAGGTGAATAGCTTGAGCCCAGGAGTTTGACACCAGCCTGGGCAACA
TGGCAAGACCCTGCTTCTACAAAAAATGCAAAAATCAGCTGAGCATGAT


invisible?    
Gene introns: 0  

>31375 121 165     18p11.23    chr18:7214677-7214557 BLAT!
AAATGAAGACCAAGACCGTGTTCTCAATGATCTCCTACTCTAAATCTAAGCAAAGTATTT
TAGTGTGGGGTTATATTAAATACATGCCGTAACAGAAGCACGTCCAAGTTGTGATGGGAA
C


invisible?    
Gene introns: 0  

>5218 101 164     2q32.3    chr2:194276586-194276486 BLAT!
CAGCATCAAAAAAATAGATAAACAAATTTTAAAATGGGCAAAAAATCTGAACAGACATTT
CTCAAAAGAAGAGTTATAAATGGCCATGAAAATATATTTAA


invisible?    
Gene introns: 0  

>10571 100 164     4p15.33    chr4:12056254-12056155 BLAT!
GGATGTCATTGTAAGAAGAGACGACCTACTGTGTGCAGTGTTGGAGACTATACAGGGGAA
TGAGGCTGTCTGCAAGGGGTGAGAGAATCTAGCAGGGGTG


invisible?    
Gene introns: 0  

>15804 118 164     14q21.1    chr14:42858248-42858131 BLAT!
AAACTGATTCTAATAACCATAGATAAATTGGAAAATCCTAGAAGGAACAAAGCAAATATG
AAAAATAAGAGAGAAATAGGGGAGCCAATACTTTTTTATTTTCATTTTACATTTTAAT


invisible?    
Gene introns: 0  

>18011 114 164     3q13.11    chr3:103420378-103420265 BLAT!
GTGTGCTCTTCCACCTGCCCTAGCAATTAGGAGACTTGAAGCAGAAGGTATTTTGAGACA
AATTTCTTTTAAGAGAAAATAAGGTAATATTTTAAACAGATTTTTGCATGTGCG


invisible?    
Gene introns: 0  

>19428 111 164     17p12    chr17:14903304-14903414 BLAT!
AAAAGATTCAGCCAATTAAATACAGGTAAAGTGTCTAAATAAACATTTTTTTCCAAAAAT
ATATACAAATGTCCAACAAGCACATGCAAAAATATTTGCCATCATTGGTCT


invisible?    
Gene introns: 0  

>25069 107 164     5q32    chr5:147197603-147197709 BLAT!
AGGGATTATAGTATTTGGATATATTTGGCTAAGAAGCAAATTTATTGACTCCATCCCAAT
ACCACCCTTAGGATACTTAAAAAACTAAGAGAAGGGAAAAAGTTAGA


invisible?    
Gene introns: 0  

>26984 101 164     8q24.13    chr8:127119622-127119522 BLAT!
CATCAGAAACTTGCGACTTATGACTTCAGGGGAGAAAACATTTCAGAACATCCAGCAATT
AATGATAAAAGAACATTATTGCGGAGCTCCTTTGGGATGGA


invisible?    
Gene introns: 0  

>15726 100 163     7q31.1    chr7:108334489-108334390 BLAT!
TCCCTGAAGGGTAAGTCCCAGGACAGGCAGCATTCAAAAGCTGACTTAAGAGACCCTAGG
CCTTAAGGGAACATCAGCAGTAGTCTGGCAATACTCCGCA


invisible?    
Gene introns: 0  

>18015 107 163     15q14    chr15:35474934-35474828 BLAT!
GAGCAGATGAGATTATTTATTATCTGAGATTATTCACAATGAAATAATATCATTTGTATA
GCCATAGAAGTTTGCTCTTTAACAATTGTCATACATTCCTTTGTTCC


invisible?    
Gene introns: 0  

>22992 102 163     9p21.3    chr9:21933398-21933499 BLAT!
ATGGAGAAGGAGTTTAAGTAACAAACCTTACCTTTGTTTAAGGTGCTTTTTCTGGCTCTC
TGCCATTAAGATCTACATTTTCCACCCTGTCTCCTCTAGGAC


invisible?    
Gene introns: 0  

>23013 107 163     6q12    chr6:66064437-66064471 BLAT!
GAGAATGTCTCACCGGGGACGGTGCCTCATGCCTATAATCCCAGCACTTTGGGATTACAG
GCATGAGCCACCATGCCCGGCACCAAGTTTTTAAAGAAAGAATAATA


invisible?    
Gene introns: EYS (64429875 - 66417118)  

>25302 120 163     15q25.2    chr15:84295287-84295168 BLAT!
AACACTGGAAAATGTGACTCAGATCTCTAGGCAAAGGGGCTTCTGTATTCTGAAGCTCAG
AAACAGGCAGACTTACCTACCCAGTCATAAAAGGCTTCAGACCACCCTTGGCTTCACCCA


invisible?    
Gene introns: 0  

>33186 119 163     17q21.2    chr17:39152152-39152034 BLAT!
TAACGAGGAAGATAACCAGCAGCACCGGGAACAGTCAAGAGCTATTCTGACTCCTCAGGT
GGTCCTCTTGACTACACGTCCCCATTCCCAAAACATACAAACATGCACACCACAATGCA


invisible?    
Gene introns: 0  

>7960 120 162     11p13    chr11:34548528-34548647 BLAT!
TAATTTACACAGAGGCACCAGGTGGGCTAACTTCATGATCTCTTCTATAGAAGGTAAGCT
CCATGAGTTGGGTGACTGTTTATTAACTTCACCAAAACACTTTTGAGAATAAATATGGCA


invisible?    
Gene introns: 0  

>12585 106 162     Xq24    chrX:120313963-120314068 BLAT!
AGTTGCTGTAATGGCCTGAGTTAGTTGGCCTCCAGCCAGGAGGTGGCACTTTCAAGAGAG
CACCAGCTGTGGTAATAGCAGTGGGATTTGAGCTTGCCTTAAGTTG


invisible?    
Gene introns: 0  

>17391 103 162     7p11.2    chr7:57770285-57770387 BLAT!
TAGCAGTGGGAGTTCTTGTCACAGAAATCTTGTGACCTCTGTGTTTGGTAGCTATAGACT
GCAATGAGTTTATCTCTTCATAGGGAAAATTGAGAAGAGATTA


invisible?    
Gene introns: 0  

>21836 102 162     8q23.3    chr8:116012366-116012265 BLAT!
GCCAGGAAAACATTTGAGTTAGATGTGATTTTTTCCTTAATTTGTCAAACAGAAGAAAGG
TAATTATGATACAGAATGTGGGAAAGGAAATCTTGTGTGACA


invisible?    
Gene introns: 0  

Shown 3001-3030 from 3142 sequences on 101 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs