Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2371-2400 from 3142 sequences on 80 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>27460 113 276     5q23.2    chr5:125379980-125379868 BLAT!
CACAACTGAGATAAAGCCTGTGCTAAATGTCACCTGCCGCTGACAAGCACAGGAAGCCAA
ACACTGCTAAATGAGTCAGTTACTCTGGGAGTGCTTAGCTCTACTTGCAGGCT


invisible?    
Gene introns: 0  

>28217 118 276     6p22.3    chr6:23637308-23637425 BLAT!
CAATTTCAGGCTTCTTAGTTATGTGGCTTTCAAGCCTGGGTATGGAAGGAACAAACAAGG
AGAAGAAGTAGGGAATTACCACAGCTGAAGACTGTAGGGCTCAGCCCTAGGCACATCC


invisible?    
Gene introns: 0  

>32327 131 276     Yq12    chrY:58980749-58980665 BLAT!
GTGGAGTGGAGTGGATAGGAATGGAGTGGAATGGAATTGAGTGGAATGGAATGGAGTGGA
GTGGAATGGAATGGAGTGGAGTGGAATGGAACGGAGTGGAGTGGAATGGAATGAAGTGGA
GTGGAATGGAG


invisible?    
Gene introns: 0  

>23081 169 275     12p12.2    chr12:20476572-20476404 BLAT!
AAAAATACATGACTAAGAAAATCTTAAAATCTTATCTCCAGAATATGCAAAGAATTCCGA
TAAAGCAATATGTAAGAGCAAACAATTCATTATTAAAAAGGGAAAATATGAGAGGCATTT
CACAAAAGAAGAAATAGGAGTAGGCAATATCCATAGGAAGAGATGCTTA


invisible?    
Gene introns: 0  

>12837 123 274     12q21.33    chr12:91642203-91642081 BLAT!
AGCTAAAAGAAAAAAAAAGTGTGAAGGTCTTAAATCAATTACCTCTGTGCAAAATTTAGG
AAACTAGAAAACCAAGAGTAAATAAATGCAAGGCAGGTAAAGTGTGAAATAATAAGTAAA
AGA


invisible?    
Gene introns: 0  

>13004 123 274     3p26.3    chr3:1834911-1835033 BLAT!
GTCAGGAGATTGAGACCATCCTGGCTAACACGGTGAAACTCCATCTCTGCTAAAAATACA
AAAAAATAGCCGGGTGTGGTGGCACACGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGC
AGG


invisible?    
Gene introns: 0  

>14972 131 274     8q12.1    chr8:58752061-58751931 BLAT!
TTTTGGAAGGTAATTATGTTTGGAAGAGGTCCTGGGGTTAGAGCTTATAAGGGGGTGAAG
AGACTACAGCTCTCTCTCTTCGTCATGTGAGGATGCAGCAAGAAAGTGGCAATCTGAATC
AGGAAGAGGGC


invisible?    
Gene introns: 0  

>22826 118 274     12p12.3    chr12:16802800-16802917 BLAT!
AGCAATATTAATTTCAGAAAAAGCAGACTTAAGAACAAAGAAAATTATTAGAAATTAAGA
AGGATATTACATAAAGATAACGGGTTAATTCAACAAGAAGACATAACAATCCTTAATG


invisible?    
Gene introns: 0  

>30429 124 274     7q11.22    chr7:67127845-67127722 BLAT!
TAATGCCAAATGGAAAAAAGGAATAAATATAAACAAGGGATACAGTGAATATAAGGTTGA
AAACATCAAAATGGTTCACGACATTTACTACCATGAGCCAACTGTCATAAATATTGTGAA
AGAA


invisible?    
Gene introns: 0  

>31649 168 274     2q24.3    chr2:165316336-165316503 BLAT!
CTCACTATCCCTCAACCTCTTTCTCCTTTCAATCTTGGCGCCACACTTCAATCTCTCCCT
TCTCTTAATTTCAATTCCTTTCATTTTCTGGTAGAGACAAAAGAGACATGTTTTATCCAT
GAACCCAAAACTCCGGCGCCGGTCACGGACTGGGAAGGCAGCCTTCCC


invisible?    
Gene introns: 0  

>9763 134 273     3q24    chr3:146033447-146033314 BLAT!
TTCCTGCTGCCATGTGAAGAAGGACATATTTGCTTCCCATTCTGCCATGATTGCAAGTTT
TCTGAAGCCTCACCAGCCATACAGAACTGTTTCCTTTATAAATTACCTAGTCCCAAGTAT
GTCCTTATAGCAGC


invisible?    
Gene introns: 0  

>24806 116 273     1p21.1    chr1:106066722-106066607 BLAT!
CAGGGATGGAGGTTATGCATGGAGTTAGCAACACAAATTCCCACTCACCAAGGCTGACCT
TGCTACGACCACATCTGAGTGTCCAATTTTCCAGTAGCAGAGACCAACACTAAGCA


invisible?    
Gene introns: 0  

>28874 130 273     Xq25    chrX:128149080-128149209 BLAT!
GTGGAGGACTCTGTCTTTGTGCCATCTTCTTGCTGCTTCTTCTGGGCTCCAGTGGGAAGT
AGAGCCCTAAAAAGTAAATAAAAGGTCCATGAAGGCCAAAATGAATCCTGTGACTTAAAG
CCAGAAACCA


invisible?    
Gene introns: 0  

>30322 100 273     9p24.1    chr9:8006505-8006406 BLAT!
CAGCCACTGCAAAAACATACCAAATTGTAAAGACCATTGACGAGGAAGAAATTCCATCAA
TTTATGGGCAAAATAACCAGCTAACATCAAAATGACAGGA


invisible?    
Gene introns: 0  

>18684 130 272     7q11.22    chr7:67129356-67129485 BLAT!
CTCATGGTTCTGGAGGTTAGAAGTCTGATATCAAGGTGTCAGCAGGACTGCACTCCTCCA
AAGGCTCTAGGAGAGAATCCTTTCTTGTCTCTCTCAGATTCTGGTTGCTCCAGGTGTTCC
TTGACTTTTG


invisible?    
Gene introns: 0  

>20272 105 272     15q21.2    chr15:51254861-51254965 BLAT!
AGAGGAAATGCTTTAGGACATTGGTCGAGGCAAAGATTTATGGCTAAGACTTCAAAAGCA
CAGGCAAAAAAGACAAAAATGACAAATGGGACTGTATTAAGGTCA


invisible?    
Gene introns: AP4E1 (51200945 - 51298097)  

>24529 145 272     17p12    chr17:15034268-15034412 BLAT!
TGACCCACACATTTTATGGATTAGGAAATTGTGACCGGAGGGGTTAAACATAGGGAGTCA
GAAAGGCAGGGTGTAAAGGCCAGATTGAAAGGTCACACCCCCAGCAGCTCACAGGGTTCT
CCTCCCTCAATGTTCCAACACCACC


invisible?    
Gene introns: 0  

>7870 134 271     3q26.2    chr3:170592105-170591972 BLAT!
ACTTTGTGTTTTGAAGTTTCACTACAATGTATATAGGTGTGCATTTCTTTAAAATTATCC
CTCTTGGGGATTCCTGTATCTGGAAATTCAGCCATTATCTCTCTAGATTTTGCCATTTCC
CCATTGTCTCTATT


invisible?    
Gene introns: 0  

>15819 134 271     13q32.3    chr13:101534058-101533925 BLAT!
GAGGGCCACTGATTATTTTACCTCTTTTCTCTTAAAGAAAAGTTAATTATAAAGACTCAG
GCCATAATTTCCCAGGAAAGTGTCAGGATGATCTAAGACGAGTCCCAGGCCTTTACCATG
AAGCAGACTCTCAG


invisible?    
Gene introns: 0  

>20428 104 271     14q24.2    chr14:71034756-71034859 BLAT!
TCCTACTCTTAAGTGTCATCTCCATCTACTGGACTACAGCCTGAACTGCACCACCAAACA
AAAAACCTGCTACCAGAAGGGCTTAGTGCTAGTCTGAGATAAGT


invisible?    
Gene introns: 0  

>27365 141 271     1p31.1    chr1:84884146-84884286 BLAT!
TTGTGGGAGGGATCCAGTGAGAGGTAACATAATCATGAGGGTGGGTCTTTCCCATGCTGT
TCTAATGATAGTGAATAAGTCTTAAGAGATCTGATGGTTTTATAAATGGCAGTTCCCCTG
CACACGCTGTCTTGCCTGCTG


invisible?    
Gene introns: 0  

>31810 103 271     21q22.11    chr21:31696367-31696265 BLAT!
ATAAAAGTTATCATCCCTATGGATGTAGAAAAAGCATTTGACAGAATTCAACAAACTTTC
ACGATAAAGACTTTAACAAATTAGGCACAGAAGGAATATACTT


invisible?    
Gene introns: 0  

>32701 122 271     1q42.2    chr1:232166421-232166300 BLAT!
TTTGGAAAGTTGAACTAAACAAGGGTCCTACGGAGCTGTGGTATTTGTGCACAAACCTGG
ATGTATTTAGAGCATGCCCTCAAGCACCACCAAAACTAAACAATTGGGCACCATGCACTC
CA


invisible?    
Gene introns: TSNAX-DISC1 (231664398 - 232177019)  

>14436 115 270     15q21.3    chr15:54147384-54147498 BLAT!
CTTTTGGGCTGAGACAATGGGGTTTTCTAGATACAGAATCATGTCATCTGTAAGCAGAGA
CAATTTGACTTCCTCTCTTCCTATTTGAATATGCTTTATTTCTTTCTCTTGCCTG


invisible?    
Gene introns: 0  

>21191 136 270     6q24.1    chr6:139982577-139982450 BLAT!
AGATTTTTGGATTTCCTTTAATAGGAAACTTCACAACCATTTCCTGAGGATTTTTGCAGA
TGAAAACAAATGGAGAATCAGATTCTTGACTGATGTCTGGAAACTGCTCCTTAAATTGCT
TCTGGGACAAGCAGTC


invisible?    
Gene introns: 0  

>24666 138 270     5q23.3    chr5:128412822-128412685 BLAT!
AATATATTTGATCTGCTTTTTGCTCAAGTCAAAGATATACTCACTTTGAGCTTTAATCCA
GAAGCAATATCCATCATTACCCCTGGCCCACTGATGAAAACTCATCATACACCTACCTAC
GTGTAAGAGAGACTGGGA


invisible?    
Gene introns: 0  

>25095 159 270     3p22.2    chr3:38891536-38891694 BLAT!
TGTGATCTGGCATCCATGTGGATTTTGAACAAAGGAAAAAACATGGGCAGTAAATCCTTA
AAACTAAAAAATGCTCATAGGGCTTATAGTTGCACAGGAAAGGTAGAACCTTGACTCAAT
TATCTGAATAAATCAGGTTACCACCACAAAAACTTCTGA


invisible?    
Gene introns: SCN11A (38887259 - 38992052)  

>26721 125 270     2p24.3    chr2:14816448-14816572 BLAT!
AGACTAGAAAATGGACTTCAGAATGGGAGACCAAGATGGTCCTTTCCCTAAGAGCACCTT
GCTGAGGCTGAGGAGTGCCACCTGGCTATAGATCTCAGGGGCTCTCTTCTCTAGGATTTT
CAACC


invisible?    
Gene introns: 0  

>28025 127 270     2q23.3    chr2:152062938-152063039 BLAT!
CCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCGCTTGAAACCGGGAGGCAG
ATCTTGCAGTGAGCCAAGATCGCACTATTGCACTCCAGCCTGCCCACACTTGTTGCCCAC
AAGTGTG


invisible?    
Gene introns: 0  

>3433 167 269     2q32.3    chr2:194647406-194647572 BLAT!
GCCTTATGCTGTTCTTGTGATAATGAGTGAGTCTCATGACATCTGACTTTTTTTTTCTTT
GTTTTCTTTAAGTTCTGGGATACATGTGCAGAATGTGCGGGTTTGTTACATAGGTATACA
TGTGCCACGGTGGTTTGCTGCACCCATCAACCCTTCATCTAGGCTTT


invisible?    
Gene introns: 0  

Shown 2371-2400 from 3142 sequences on 80 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs