Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2581-2610 from 3142 sequences on 87 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>16861 101 234     6p25.2    chr6:3789163-3789063 BLAT!
CTCTGTGACGTGGAAATTACAACACGTGAGCACAGAGAACAGCACAGAGTGCATTCCACA
AATGGTGGCTCTTGGCTGACCCAGACCCAGTGAGAGGCAGC


invisible?    
Gene introns: 0  

>17227 147 234     13q21.32    chr13:65901054-65900908 BLAT!
CACACAGGATCAGTTGTCAATTAGATGCACACTAATGAGAGATCTTACCCAGTTTAAAGC
TTTAGTAGTAATGTTAATGATACAGAACATCAAGAGGCCTCAACCAAGCAGAAAGAAGTC
TGGGATATTGTCAACAGCTCCCCTTGA


invisible?    
Gene introns: 0  

>17412 105 234     2p22.3    chr2:35425336-35425232 BLAT!
AGAACAAAGTTAGAGGACAGATATTACTCAACTTCAAGACTTACTGTAAAGCCACAGTGA
TCAAGACAATGTCTATTTGTGACAGAACAGACAGACGTCATCTGA


invisible?    
Gene introns: 0  

>19681 128 234     2p16.1    chr2:57387722-57387592 BLAT!
CACTCTAGAGTAGAAGGGTCTTTGGAGTGGCCATGCAGCATGTCTAGCAGAGATATATTA
TAAACCTTTACTGAAATTCTCGTTGTTTTCCAAATATACCATGTTCTTGTGTTCTACTGG
GATTTTGC


invisible?    
Gene introns: 0  

>20032 111 234     2q31.3    chr2:181673225-181673115 BLAT!
TTGGTTCAACATTTCTTATCTGCTTTCTGTCATAGGAAGAACACATTGAGTGTAGTATTG
GTAGGATCCTTCAGCACCCTGCTTCTGTTATGGAAGCTCAATGGGAAAATT


invisible?    
Gene introns: 0  

>22869 137 234     1p31.1    chr1:70864640-70864504 BLAT!
AGGCGTTAGCTTCCAAATCTGGCCAACAGCAATTTTAAAGAGCTTCTCTGGACAGGTTTT
AAAACACGCCACCTGTAATCCCAGTTACTCTGGAAGCTGAGGCGCAAGAATCACTTGAAC
CCGGGAGACAGAGGTTG


invisible?    
Gene introns: 0  

>27306 117 234     12q12    chr12:41044626-41044742 BLAT!
TGCTTTCTCTGATTTTGTTTTCTTTGCCCAGTTGCAGCCCTTCAAAGCTTCACTCTTAGT
TACCAAGCAGACTTTCTTCCTGCTGCTCCATCTCTTTTTATTGAGGTCACTTCAATC


invisible?    
Gene introns: 0  

>4097 107 233     14q12    chr14:28746593-28746487 BLAT!
AACTTAACAAGATATAGGAATGAGGGTGGAGAATGGCAGAGGCACATTATTTTCTGGGAA
TTTTAGCTCCACAAATAAATTGTCACAGGTGGGCTTTCAGAAAAACC


invisible?    
Gene introns: 0  

>8277 110 233     7q31.2    chr7:116893806-116893697 BLAT!
ATGGAGGATCAAGTGAAATGTGTTAAAATGTAACTTTGGCCTATGCTTCCTAATTTCTTT
ATATTGATTTGGAAATTTTCATGGAAAATGAATTTGGGGGGCTCATATTA


invisible?    
Gene introns: 0  

>8538 104 233     10q24.1    chr10:97059499-97059602 BLAT!
GAGGTCAGGAGTTCGAGACCAACCTGACCAACATGTTGAAACCCCATCTCTACTAAAAAT
CCAAAAATTTGCCAGGCATGGTGGTGCACACCTGTAATCCCAGC


invisible?    
Gene introns: 0  

>11300 154 233     2q24.2    chr2:161402750-161402903 BLAT!
AATTTGCATTTCCCTGATGACACATGATGTGGAGGATCTTTTCATAAGCTTATTTGCCAT
CTGTAAACCTCCACTGATGAGGTGTGTGTTAAGGTCTTCGGCCTATTTTTAAATGAGGTG
TTTGTTTTCTTTTTATTGAGTTTTAACAGATCTT


invisible?    
Gene introns: 0  

>19119 120 233     10p12.1    chr10:25670691-25670810 BLAT!
CTTATTTTGTTTAGCATTTTTTATTTTAAACAACAATTTATTTTAGCAAAATATTTAAAG
AAGGACTACTCAAAAACAAACAAATCAAGCACACATGAAGTTTTTTATTGTAAACAGGGT


invisible?    
Gene introns: GPR158 (25464289 - 25891157)  

>21408 113 233     1p34.3    chr1:39148991-39148890 BLAT!
TTTAGTAGAGACGGGGTTTTACCACATTGGCCAGGCTGGTCTCTAACTCCTGACCTCAAG
AGATTTGCCTGCCGCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGTCACT


invisible?    
Gene introns: 0  

>24671 105 233     2p22.3    chr2:36243942-36243838 BLAT!
TCAATTCCTATTGTCAGTGTTGTGTAGATTTTCCTTCTGTATGTCTTTACATTTCACCTA
CTTTCTATCTTCATAACTGCAACTCTAGTCCAAACTGTTATTATC


invisible?    
Gene introns: 0  

>33061 103 233     4p12    chr4:46450615-46450513 BLAT!
TTTCTGAGGCTGCAAGGTTGAGAGTGAGATCCTAAACCAATGGTCAAAGGACAACCTGCA
GCAGAATCACCTGGGTAAAGGCTACGCATTTAGGTCTGTAAAT


invisible?    
Gene introns: 0  

>2683 114 232     6q24.2    chr6:145539368-145539255 BLAT!
GTGGTCCCCAAGACCACAATCTAACTTGATGATTTGCTAGAGCGGCTAACAGGACACAGC
GTATAATCCTGCTCATGGCTATGACTTATTACAGTGAAATGATACAAAGCAAAA


invisible?    
Gene introns: 0  

>4902 134 232     3q11.2    chr3:97695650-97695517 BLAT!
AATCATTTAAGAAAAGTCATGCAGCCTAACACCAACTTTCCTATAGGCACAGGCTGTAAA
AGAAATTGGACTCTAAGCAAGAAAAGAAAATAGGAATGCTTACCCAATTCAATTTTGTAA
ACAGAGTAACTACT


invisible?    
Gene introns: 0  

>7117 109 232     6q11.1    chr6:62191969-62191864 BLAT!
TAAATAAAAACTAGAAAGAATTTACCTTAAAACTACTTTGTAATGTGTAGATTCGTCTCA
CAGATTCAAACATTTCTTTTGATTCAGCTGGTTGGAAACATTGTTTTTG


invisible?    
Gene introns: 0  

>10351 128 232     6q25.2    chr6:154870259-154870132 BLAT!
TGTGTGTGTGTGTGTGTAGGGAGGTTAAGACTTGATCAAAGCCTGGGCAAAAAGCAAGAT
CCTGTCTCTGCAAAACATTTTAAAAATATTAGCTTGGCGCAGTGGTGTTCTCCTGTAGTC
CCAGCTAC


invisible?    
Gene introns: 0  

>18198 123 232     8q24.23    chr8:137475600-137475478 BLAT!
TCAGTCTAAGAATCCAGCCTCCATATTGTGAGGAATCCCAAACTAGCCTATATGATAGAT
AACATGGAGAGGCCAAAAATAGGGGTTCCAGCCAACAGCGCAGTGGACCGCTGTGCTGAC
AAC


invisible?    
Gene introns: 0  

>18461 116 232     2q23.3    chr2:152062331-152062446 BLAT!
ATAAATTACATAAAGTCCGGTGTCATTTCAAAGAAAGGATTTTCCCTCCTTAGAGTAAAG
GCATGTATTGTTAATTCTTTACTAGGATAGAAGGAGAATAGCCATCATTTTCTACC


invisible?    
Gene introns: 0  

>25461 104 232     12q24.21    chr12:115063620-115063723 BLAT!
CGGGAGGATCACTTGAGGTCAGGAGTTGGAGACCAGCCTGGCTAACATGATGAAACTTCA
TCTCAACTGAAAATACAAATATTAGCTGGGCATGGTGATGCATG


invisible?    
Gene introns: 0  

>26231 125 232     2p23.2    chr2:29599990-29600114 BLAT!
TGGTTTTCATATTTTAAATAAGTGTAACATCTAGGACCAGACCATAAAAACTGGAGTTAA
TAGGAGAGCTGAGGCCGGGCGTGGTAGCTCACACCTGTAATCCCAGCACTTGGGAAGCCA
GGGTG


invisible?    
Gene introns: ALK (29415639 - 30144432)  

>26724 128 232     8q22.3    chr8:103383167-103383040 BLAT!
GTCATTTGCAACAACATGGATGAGCCAGGAGGACATTACATTAAGTTAAATAAGCCAGGC
ACAGGAAGACAAAAACTGCATGTTCTCATTCATATGTGGGAGCTATGATCCCATATATCA
TCCCATAT


invisible?    
Gene introns: UBR5 (103265568 - 103424495)  

>28410 155 232     3p26.1    chr3:5782944-5782790 BLAT!
TGATCATATGTAAATGAATGAACATAATATGTGCCAATAAAACTTTATTTATGAAAACAA
GCCGCTGGCTGGATGTCGCTCCCTGGAGCCCTGAATGCTCATTTGCCTGCATGTCAGGAG
GTTAATGAGAGCTGTCACTAGTGACAGGGGCTGGG


invisible?    
Gene introns: 0  

>5122 145 231     6p12.1    chr6:54150834-54150978 BLAT!
AGTTCTAAAGGGTCACTTGCTTCCCTGCCTTCACACACCCTTCCAATAAATTTGCTCATT
TTTTCTGAAAATACTACGAGTTGGATTTTGCATATATAACTAAATGAATCTTAACAGACT
GATAAGATATTAAAGCTTACAGCAT


invisible?    
Gene introns: 0  

>16862 116 231     1q41    chr1:219464433-219464318 BLAT!
AGAAGCTTACTCAAGCGTTGGTTAACAATCCTTGAAGTGGGTGCTATTAATTCCCTATAT
TACAAACAAGAGAACTGACAGAATGATACTAAGTAACTTGATTGAGATTTTACAGC


invisible?    
Gene introns: 0  

>17180 113 231     21q21.1    chr21:20572242-20572354 BLAT!
CCTGGCTAACATGGTGAAACCCCTTCTCTACTGAAAATACAAAAAAATTAGCTGGGCGTT
GTGGTGCATGCCTGTAGTCCTAGCTACTTGAGAGGCTGAGGCAGGAGAATTGC


invisible?    
Gene introns: 0  

>17288 153 231     19q12    chr19:31274763-31274611 BLAT!
TGGGCAAGAAAGACCTGAGTTTTCCTGCTGGATCCACACTTTCTATGCATCGTGAGCAAG
CCCCTAAGTCCCTTCCTCCCTCTGAACTTCAGCTACCCCAACCAGATGAAGATTTTAAGG
CTCCTCACAGCTCTAACAGCTATCACACGGGGG


invisible?    
Gene introns: 0  

>26693 100 231     Yq11.223    chrY:22581899-22581800 BLAT!
CAGCATGTAGAGCAAACAAAGGCAGTAGTCAGGGTTTGGTTACAGTAGGCCCTGGGCTGA
ACACAGTGCTGTCCTGGCTTCAATTCTAACCCAGCACATT


invisible?    
Gene introns: 0  

Shown 2581-2610 from 3142 sequences on 87 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs