Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1651-1680 from 3142 sequences on 56 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>11263 104 458     2p11.2    chr2:85311913-85312010 BLAT!
TAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAACAAAAAATTAGCTGGGCGTGG
TGGCAGGCACCTGTAGTCCCAGCTACTTGAGAGGTTGAGGTGGG


invisible?    
Gene introns: 0  

>5711 132 457     6q14.1    chr6:75932801-75932932 BLAT!
CCATAACAAAACTACCAGAAACAACAGAAATTTACTTTCTCATAATTCTGGAGACTCAAA
GCCCAAGGGTGAGGTGTCAGTAGGTTTGGTTTCTTCTGGTGCCTCTCTCTTTGGCTTGCA
GATGGCTCCTTT


invisible?    
Gene introns: 0  

>19284 133 457     21q21.3    chr21:28145653-28145757 BLAT!
ATTTTTAAATTCTACCAAGTAGGTGATGCTACCTCCAGTTGAGAACCACTGAATTAGACA
AAGAACAAAAGACTAAACCCAGAGACAGACATGTGAGATAAGAGCCCCCGCGTACCTGCC
CGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>20402 113 457     13q31.1    chr13:85866486-85866598 BLAT!
ATAATGTTTATATAAAAAACATAGACATTTAAAATACATTGAGAATATGTGAGAACAATT
TTGATAATACATTTTGTTAAAATGAGAAAATAATGGAAATGGAGACTTTTCAA


invisible?    
Gene introns: 0  

>27146 157 457     2p16.1    chr2:56722851-56722695 BLAT!
CATTCATTTTGTATCCTGCAATTTTGATGAAGTTGTTTATCAGCTGGAGAAGCTTTTGCA
CTGAGACCGTGGGATTTTCTAGATATAAAATCATGTCATCTGTAGAGATAGTTTTACTTT
CTCTCTTCTTATTTGGATGCCCTTTATTTCTTTCTCT


invisible?    
Gene introns: 0  

>29710 118 457     12q12    chr12:38916727-38916610 BLAT!
CCCTCACTATTTTCATTAAGATAATTTCCTCCTGAAAGGAGGGATACTTTCTTTCCTCTG
TAATTTCTCATATTCTTCTATCTCACTAGGTGAATGAAAATGTATTTAACATAGTCCT


invisible?    
Gene introns: 0  

>3184 179 456     5p13.2    chr5:34488537-34488359 BLAT!
AATTCCTAGAAGTAGAATGACTAGATCGCTTACGCATTTTCTATGATTTCTCTGCGTAGC
TCAGTGACTCTATTATCTCTCCTGCTAAACTCAGTTTCTTACAAAACAAAATACAATGAA
ACTTTGCTAAATAAATAGACAAAAGTAGTATTGGCATACATTTATCCTATGATGGGTGA


invisible?    
Gene introns: 0  

>6162 153 456     9q32    chr9:116479809-116479961 BLAT!
GGATGCCATGTTTGGCAGCTGGGCTTAGGGACACAGACAGCTAATACTTCACAGCTATTG
TTTCACTTAATCCCTCCAAGGGCTCTGTGGGGTAGAAACTATTATTAACACTAGTTGACA
GGTGAGAAAACTGCAGCATAGAGATGTTAAATA


invisible?    
Gene introns: 0  

>17532 153 456     14q21.1    chr14:39031237-39031094 BLAT!
TGATGGAATGGGCTGTGAAATGCTCAGTGGTCTTTCTTGATGGATGGGCCATGAAATGCT
CAGTGGTCTTTCTCCATGCTTTGTCTTGGAGTGGGGGTTGAAGCTGGGAAAAGCTGGACT
GGTCCAGCCTGCACTTGGGCCCCCCAGTGGCAG


invisible?    
Gene introns: 0  

>26598 159 456     1q24.2    chr1:169457552-169457394 BLAT!
AGATTGGGCCCACCTGGAAAATCTCACATCTGTCATAAAACGTAACATAATAACAGGAGT
ATTGCCTCATCAAATTCATAGGTTTCACCTCACACTCAAATGGGTGGGGGTTATACAAGG
GCAAGCGTCACTGGGGATCATTCTTAGAATTCTGCCTAT


invisible?    
Gene introns: 0  

>6443 155 455     2q36.1    chr2:222095026-222094872 BLAT!
AATAATGGTTCTCATTCCCTTGAAGGCTGGTCACCACTTTAGATTCCTTTTCAATCCATG
TTTCATGTATTCACTACCAATTGAATAAAAGTGGCTTTCAGCATGAAACCTATTTGCCCT
CTCTGCCTTAGAGGTTTTTTCCATGTAATTTAAAA


invisible?    
Gene introns: 0  

>8051 153 454     2q31.1    chr2:177726376-177726528 BLAT!
ACATAGAAGATATGCAAAGGGCAAGGTATGTGGGAAGAGACATGGAGCTTTCATGCCCTC
TCCAGGTGCACCACCCTCCAGGGACCACAATTGATTGCATCATTGGTCATTAGTGATCAG
CTCAACCTTCAGACCCTCTCTGCTTCCTGGAGG


invisible?    
Gene introns: 0  

>13795 114 454     16q23.1    chr16:76198890-76199003 BLAT!
AAAATTTAAGTTTCTAAAAGTATTTTATTTCTCAAAATGCTTTCCTATTGCCAGTGAATC
TGCTTTTAAAACTCTTTACCATACAAAATTACTAATGGATATGTGTTCAGCACA


invisible?    
Gene introns: 0  

>28272 163 454     20q11.23    chr20:36243453-36243615 BLAT!
GATCCAGAGAGGAACAAGGACAGAACTGAAGTCACAGAGAGAGTTAGCCACAGGGTGGGC
GCTAGAGTCTAGACCCCTCCACTGTTCCCACCATTCCAAGGTAGGAGCCCTTGCTGAAAG
GAGGGGCCAGGGCTTTTCCTGCTTCCAGATATTTTCACGTCCT


invisible?    
Gene introns: 0  

>28596 105 454     6q23.3    chr6:136125526-136125630 BLAT!
CAAAAATTCTGTCAAATTTGTTTAACCAGAATCTCTCACCCTTCATATCTGATCATTGTC
AATATTTGACCAAATTCCTTATCTCCCACCACCTCCCAGATGATA


invisible?    
Gene introns: 0  

>2849 179 453     7p12.1    chr7:51736382-51736204 BLAT!
TGACAAATCAGAGAAGGTGACCCTGAGCCATTGCGACTCAACCAGTAGGCTACTGGAACC
AAGACATAAAAATGCTACAATGTCTTAAGCACATTAAAGGGCAAACATGTGGGAACTGTT
AGTGGCACATTCATAGGAAGTCCATGCTATTCTCCACATTGGTGTTAGTGCGCAGATGT


invisible?    
Gene introns: 0  

>4645 109 453     6q22.1    chr6:118225221-118225329 BLAT!
GTGTGAACAGTCTTTGATATCTGTTGCCTAGTGTCTGTTTCCCTGCTCTGTGCATATTTT
CATATCCACTAATACCATTTATAGACTATCTTCATTGATGATGATTGTT


invisible?    
Gene introns: 0  

>8366 170 453     8p22    chr8:15042642-15042811 BLAT!
AGGTAAACCTCACACACTCTCTGAAGCAAAGTTAGGCATTAAAAGATCAAAGTTAGGAGG
AAAAAATAGAGGGAAAGCCAGGGCTTGAAGTCTGTCTTCTGCAGGATACTCCTGAAAATT
TCCACTGAAGAATTAACAACAGCAGATTTTTACTAAAGAGCCAAAGCTCT


invisible?    
Gene introns: SGCZ (13947372 - 15095792)  

>8549 190 453     10p11.22    chr10:32400594-32400693 BLAT!
TTCTAAACCTCTCTTGACCAGCAGTATCCCATATTGCAAGTTTAGCCTTATTTCCATCCA
CTGAAATTGTTTTCACCTTAAAGTCAACACCTATTGTTGCTGCAAGTTCTGGATCAAACG
TATCATCTGTGAACCTCAAGAGCAGGCTGGACTTGCCCACCCCACTCTCGCCGATGATGA
GGATCTTCAG


invisible?    
Gene introns: 0  

>17529 138 453     2p15    chr2:62576533-62576670 BLAT!
TTATTGAAGCCATCCTTACAGGGTTAACAAGAATTTTGGCCAGAAATATAGTTATAATTA
AGCATTATCGGGTGTGGTGGTTCATGTCTGTAATCCCAGCACTTTGGTGAAGCTAAGGCA
AGTGGATCACCTGAGGTC


invisible?    
Gene introns: 0  

>22142 174 453     1q24.1    chr1:166671372-166671199 BLAT!
AGGTTGCTAGATTTAACTGATATTAATTATATAGCGTGGCTTTAAGCTCAATTTTTAGAA
AAAGCTTCATTTTGAAAGGGCTTAGGGGCTAATTATCTAATATTTATCTCTAGATTTCAG
TCCTACCTTTGTAGTTCTCAAGCTGTGCTAAGGGGAGAATTTTTATTGGCTTTT


invisible?    
Gene introns: 0  

>25174 174 453     6q16.3    chr6:104414000-104414173 BLAT!
ATGGGGAGACTGCCGCCATGATTCAGTCACCTCTATTCCTCCACACATGTGGATTACAAT
CTGAGATGAGATTTGGGTGGGGATAGGGTTACAGAGCCACACCATATCATTTCACCCCCG
GCCTGTCGCAAATCTCCTGTCTTTTCACATTTCAAAATTAATAATGCCTTCCTA


invisible?    
Gene introns: 0  

>9457 153 452     2q37.3    chr2:240988983-240988831 BLAT!
GAAAGTCTTGATCGGGGATTGTTATTATATCTCAGGTTAATACCTGTGACATTTTGAGTT
TCTTATTGAGGAAGAGTTTAAAACTCCTACATTCAGACCAGGTGCTTGTGCAGGCTGCCT
CTCTGCTACCCTCAGGCATGAATAATTCCAGGT


invisible?    
Gene introns: 0  

>22164 169 452     3q13.11    chr3:102895365-102895533 BLAT!
CCTTTATAATTAGTGATATTGAGCATCTATTGATACGTTAACTGGCCATTTGAGAAATGT
TCTCTTAAGTGTGTTACTCATATTGATCAGGTTGTCTGCTTTTTGTTGTTGTTGTTCAGA
TTGCTTTTTGTTATTGTTGTTGTTGTTGAATTTTAGGAGTTCATGTATT


invisible?    
Gene introns: 0  

>26749 152 452     2q36.1    chr2:221866527-221866376 BLAT!
ATAAAGCCTGAGAATGAACAAATATAAACGCTAGTCCCCAGATACAGGAAAAACAAAGAG
TGTATCCAACATAAACAAATGAGGAACACATTATTGGAACTGTTGGATTCTATCTGTGTG
TGTGTGTGTGTTGATAAACTGCAACAAATCTA


invisible?    
Gene introns: 0  

>17727 159 451     3q13.2    chr3:111939887-111939729 BLAT!
ACTTGGCTCCCTCTACTATTAATATTAATACTATAGTATTACAGCAGAGCTGTCTGCTCT
ATACCCCACCCTCAGGCCAAACTACCTATTTTCAGTTTCCCAAATTTGCTGCATTCATTC
TTACCTCCGTGATTTTGAACAAGCTGTTCCTTCTGACTG


invisible?    
Gene introns: SLC9A10 (111859751 - 112013074)  

>27655 156 451     4q32.1    chr4:156485337-156485492 BLAT!
TTGCGACTTCTTATTCTTCTGTGCACTCTTTGCCAGCCTGTCTTGGAGGAGAAATTCATA
TTACTGTCAAGAGAAAATTACTTCCAGTTCTTTTGCATGTCAAATCTTGTCATTTCTGCA
GGTGTGGCCCATTGTGACTCAGGATGCGAGGTGAGG


invisible?    
Gene introns: 0  

>17588 143 450     7q21.11    chr7:83460433-83460291 BLAT!
GGCAACTCACAACATAGAAACTGGCTTCCTCCCATGTAAGTGATCTGAGAAAGAACAAGA
AATAGGAGAGAGAGAGTGCTCAGGCTGGGAGTGTGGTGGTGCTACCATGGCTCACTGTAG
CCTGGAACTCCTGGGCTCAAGTA


invisible?    
Gene introns: 0  

>20029 158 450     2p24.1    chr2:20729383-20729540 BLAT!
CTCACTGGTCTCTTTACTAAGGAGTTTTTCTTTTTCATAAAAATCTTGGCTTTTTATTTT
GATTTCTTCTCTGTGTTTTTCATTCTTTAGTATTTCCTCCATAGTAGGTGGAGTCTTTCT
TGTTCTTCTAATCCAAGCTTCCCATTCTGTTGGAATAT


invisible?    
Gene introns: 0  

>1233 139 449     11q13.2    chr11:66749213-66749330 BLAT!
TTTGGGAGGCCGAGGCAGGAGGATCACTTGAGGCCAGGAGTTCGAGGTCAGCCTGGCCAA
CATGGTGAAACCCAGTCTCTACTAAACAAATAAAAAAATTAGCCAGGTGTGGTGGCGAGC
ACCTGTAATCCCAGCTACT


invisible?    
Gene introns: 0  

Shown 1651-1680 from 3142 sequences on 56 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs