Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 901-930 from 3142 sequences on 31 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>30729 217 863     2p12    chr2:75616618-75616834 BLAT!
TACAGGAGGAAGTGAGAGAAAGTAAGAGCAATACTCATGGGAAGTCTTCACATGCTCGTG
AAAACAGCAGCCCTTGGATTCAAGAGGGAAACATTTATTTGCCCTCTGGACATAAAGTAG
TAATGTCTGGAGGACTTGAGGTGTGGGAAAAGAACTCGAAAATGGCAAAGGAAGAATTTC
CCCTCTTCCCAAAGGGGTGCTTACTTGAAAAAAAAAA


invisible?    
Gene introns: 0  

>1034 190 862     2q31.1    chr2:174908713-174908902 BLAT!
CCTGTAATCCCAGCACTTTGGGAGGCTGAGGCAGGGGGATCACCTGAAGTTGGGGTTCAA
GACCAGCCTGATCAACATGGAGAAACCCATCTCTACTAAAAATACAAAATTAGCTGGACG
TTGTGGCGCATGCCTGTAATCAAAGCTACTCGGGAGGCTGAGGCAGAAGAATCACTTGAA
CCCAGGAGAA


invisible?    
Gene introns: 0  

>4327 218 862     9q33.3    chr9:128954098-128953879 BLAT!
GTCCAAAGGCAGGAGGAGAAAAGGTGGCCTGCTATGGAAGGGAGAGAGAGCAGAGGGAGA
GAGAATCCCCCTCCCTTCTGCCTGCCTGTTGGTCCCAACCCCTTTGCCCAGTAATTAGAT
GATGCCTACCGACATTGAGGGCGAGTGTTCCTCTCTCAGTCCCCTCACTCACATGCCAAT
CTTCCCTGCAAACACATTCATAGACAGACTCAGAAACC


invisible?    
Gene introns: 0  

>27841 206 862     6q16.1    chr6:93102090-93102295 BLAT!
CTTGCATTCAACCTTCAAGCCTGTGAGTGACCCAATTTTTCTTGGAAGTGGGGCAAGAAC
TCAGGATACAGAAAGCTGTTACACTGGCCCTCTGCCCTTGCAGAAAGGCAGAGGGTCCAT
TGATCTGAGTCACACTCAAGCATTCTGTGGACAGCAAAGCTGAAAGAGTTTTGTAACACT
AGGTTTACAGGCACCCACACCTTAAA


invisible?    
Gene introns: 0  

>4986 210 858     10q21.1    chr10:55524549-55524758 BLAT!
TGTAATTAAGTTAAAATGAAGCCAGTAGGATGGGCCCTAGTTCAGTTTGCTAGCATCCTT
ATAAGAGGAATACATTTGGGGCTAGGCGTGGTGGCTCACACCTGTAATCTTAGCACTTTG
GGAGGCCGAGGTGGATGGATTACCTGAGCTCAGGAGTTCAAGACCAGTCTGGACAACATG
GAAGAACCTTGTCTCTACAAAAAATACAAA


invisible?    
Gene introns: 0  

>13245 190 858     1p35.1    chr1:34046098-34046287 BLAT!
GATCACTGTTAGGCATTATCAGATCATATAAAATTGTTAAACTTATCCTGAAGACAAAGG
CTGGCAGTATGAGAAAAGAGGGAAGAGGTTCAAGAGGGGAATGGAATAGAAAAATAGGAG
GTAGGGGAATGGCAAAGACCACTTAGCTTCAGGTGAGGCAGATTTAGGAGGGGAATGGCC
GCCCGGTCTC


invisible?    
Gene introns: CSMD2 (33979608 - 34631443)  

>21022 270 857     Xp11.4    chrX:40749898-40750167 BLAT!
TAAACCTCAGGAATGGTGTGGTCCATTAGGCTTTTCATAATGCTTGGTGCCATCCGCTTA
ATAATATGTTCAAAGATAAAAGCAGGCATGATTGTAATAGTAACTACAGTCCCAGATGTT
GACAGTATGTCTGCAATTTGAGAGTCCTTCAATCCAATGACATTCTGTCCATTGATTTCA
CAGATGTTATGTTCCGTGAGAAGACCATTTCTGGCTGCAGAGCTATCTTTCACTATGGAT
GTTATTTTTCCATTTTTAAAGATAAAACCA


invisible?    
Gene introns: 0  

>29318 177 857     6p12.3    chr6:47116390-47116490 BLAT!
GGCTCATAGCAAGAGAACTTTCTGGCCAGTCTACTGAGAGCTGGAAGTAATTCTCTGCCA
TTTCTAGCCTTTCCCGGTACAGCATGTATCAACTCATTCAATCCCCAGAACAACCCTATT
TAGCAGAGCTAACCTCATTCCACAGATGGGTTTTTTGTTTGTTGTTTGTTTGTTTTT


invisible?    
Gene introns: 0  

>21799 192 856     5p15.33    chr5:1355094-1354903 BLAT!
GAAATATTTGAAGAAACCTTCACTGCAACATTTTCAGACTTGAATCTCACAGATTGATAA
GCTCAGTAAGCCCCAAGCAGGACAGACAAGGCAAAAGCGCCAGACAAATACACACAAAAC
ACAAAGAAACACAGAAGAACAGCTGCCAATCTGTCATCAGAAGCAATGCAAGTCAGAAGA
CAGTGGACTGAA


invisible?    
Gene introns: 0  

>10134 190 853     Xq26.3    chrX:135538878-135539067 BLAT!
TAAAAACAACAGACATTTAAACAGAGTCGTGATTCATGAGTTTTCCTGCTGCAGAGTTAA
AATACTATTTTACAAGTAGTATCTTTATATCTGACCTCCAGCACTGAATGGAATGAACTG
GGTAGAAAGGATTTTGCACAGTGAACCTTCACTCATGGAACCCAGATGCTATGGAAATTT
GATCCAGCTC


invisible?    
Gene introns: 0  

>21884 185 853     11q21    chr11:95498249-95498433 BLAT!
TTCTTTATTGCATAGGGCTGTTTCGTGCATTGTCGAATATTTGGCAGCATCCCTGGCATC
CACTCACTTGATGCTAGTAGCAACCTCTCCCCAACCCCACCAGTGTGATAATCAAAAATG
TCTCCGGACATTGCCAAATATCCCCAGGGGAGCAAAATCACCCTCAGTTGAGAACCACTG
GAATA


invisible?    
Gene introns: 0  

>5318 194 852     14q21.1    chr14:38104092-38103899 BLAT!
TTCTTAGGAAATTATTTCACTGGAAATAGAATTCTGGTAGTTCTTTTCTTTCAGCATTTC
AAAATGCTGTGTCAATGCCTTCTGACTATAATAGTTTTCAATGAGAAATCTACTCTCAAA
TTATTTTCTCATATTGGTTAACATATTGTTTCTCTCTCACTGCTTTAAATTTTTGTTTCT
TTGACTTTAGTTTT


invisible?    
Gene introns: 0  

>23978 285 852     5p14.1    chr5:24842501-24842217 BLAT!
TGCCAACAAAATAAAAAAGGAAAAGAAAATCACAGATATTAAGGCATTTTACAGTCAACG
ATGATGATGATATTTGAATTATTAATATAGTTACTGTTATTATTTTAAACATAGAGAACT
TGAAAATAGTGTCTTACAGGAAAATCCTAGAAGATAAGTAATTACAACTATATAATAGAA
AAAGAAAGCCTTTTGCTGCATTGAATTTTCAAGTCAATTGCCTAATTTCTTCAGAATTAA
CATCTATTAATTCAATATTTTAATGAAATAACTAGGTTGTGTAGG


invisible?    
Gene introns: 0  

>7032 193 847     18q12.1    chr18:31898409-31898601 BLAT!
TATTGTTAATCTTTAAAATTTACATTAGAGATTCTGGCCACAACCTGTATTTCTCCATTC
TAAATTAAGAGCTGATAGGATTTTCCTGTATTTCTCCAGTCTAAATTAAGAGCAAATAGG
TATCTACTTACAGCATCAACAAGAATACACCCTGCTAGAGTCCCTTCCTTAGTGTGTGTG
TGCACAATCACAC


invisible?    
Gene introns: 0  

>15760 188 847     2q36.1    chr2:222644391-222644204 BLAT!
GTGTCACATGGCTACCTTTAGCTTCAAGGAAAGCTAGGACAGGAAGCAAATGAAAAGGGA
GTTCAGAGTAATGGTAGAGTCAGCCTATGAATTATGATTCCTCCCACTAGAAGTTTACAG
TGTCATGATTATTATTCCCTGACCCAGGAACCTAGGGTCCAGACCTGATCCATGATGGAT
GACTTTTA


invisible?    
Gene introns: 0  

>25566 156 846     4q12    chr4:58969575-58969426 BLAT!
AAATCATCATATGGGAAATTCACAACACCTTGCTGAGCAGTATCCCGTCTTCGAAAGCTG
TCTGTAAGAGCCCTCAGTTTGACGCAGCAGGCGATGTAGTCGTCGAAGGTGATCTTTCCA
TTGGTGCTGTATCGTTTTGCAATTGAATTCACAGCC


invisible?    
Gene introns: 0  

>2308 171 844     19q11    chr19:27749666-27749496 BLAT!
CCATCAAAAGAAAGTTTCAACTCTGTGAGTTGAATGCAAACAACTCAAAGAAGATTCTGA
GAATGCTTTTGTCTAGTTTTTATGTGGAGAAATTCCCGTTTCCAACGAAGACTTCAGAGC
ACTCCCAATATCCAATTGCAGAATCTACAAAAAGAGTGTTTCAAAACTGTT


invisible?    
Gene introns: 0  

>27682 180 844     1q23.1    chr1:157029502-157029680 BLAT!
CGTTAACAAAGGAGGAATGGCCACGAAATTCCTTCAGGGTTTTCCCAGATTTTAAACCAT
GAATTCTAATTGTCTGGTCAAAAGAAGCACTAAGGATCTGACTGCTATCCTTAGAAAAGC
TTAGACAGGTGACACCCTTACTGTGTGCCCTCTCAAATCTCCTTAAACATTGTCCACTCT


invisible?    
Gene introns: 0  

>6051 203 843     8q23.3    chr8:116129330-116129532 BLAT!
ATGTTTCAACATGACGCCTAACATGGAATGACATTCCCCAGCAGGAGTGCGTCCATTGGA
TTCTGCAGGACAGTTACTAAATAGTGCTACCACATGGTAGTAAGAAGGGACAGAATTTAT
GGTCTGTTAGGACTTCTCTGACCCAGGGCCCTCCAAAGGCTATATTCTTCCCAAGGCACC
AACATCTAAAGGTTTGCCTTTCG


invisible?    
Gene introns: 0  

>25370 216 842     2q32.2    chr2:190111582-190111797 BLAT!
GCCATAAGACTCAGCCCTCTGGACTGAGGAGAGCTGCCTATGGTCTTTGAGAAAGAGAAG
ACTGTGTAATAACCTGAAACAACACTATTGCTTCTACCCAAAGTTAATGAATTTTAAAAT
TTAAAGAGCTACATCAAACCAATTCTTCTGAGGAGTAATAACTGTCCCTCTACTTCCACA
CAGAACAAAAAAAGCAAGATTGAGATGGAGGAAACG


invisible?    
Gene introns: 0  

>32918 180 840     21q21.3    chr21:30111721-30111900 BLAT!
TTAGAAGGAACTAAATATAATATGGTATAGATAAAAATAGACAGAATTACTCAGAACTGA
GGGAAAAAATAAGTAGTGAGAAAATGTTAATAAGATCTGAATGCCATCTTCGTGGCATTT
TTCCCTAAACTTCATCAGTTGGGAGAAAACTAAATCTTCAATATTAAAAACAAGTCTTAT


invisible?    
Gene introns: 0  

>27539 239 837     3p14.1    chr3:63990520-63990387 BLAT!
TAGGGGAGTGCTTTTTGTTAGGACTGGGGACAGGGGCAGGTAAAGACAGATCTTTGAAGC
AAAAGAGAGTGAGAATGCAAGACATGGGGAAAGAGACTTAAGTGCTCCTTTGCTTTTCCA
CAGTTTTCAGTACACACAGATGACAGGGCTAAACTGCAGCGGCAAGTTACCGCTAGGAAA
TAGCTCCAGCTTAGGGGAGTTTCCCTCTGTGCTTTTTCCCAGAAAGCTGCTGGCTTTCT


invisible?    
Gene introns: 0  

>20602 202 835     17q11.2    chr17:26558268-26558067 BLAT!
CTCATTGTAGGTGTAGTGCTAGTAATAGGAACTTGCTTGCTGCTCCCCTGTGTATTACCC
TTGCTTTTTCAAATGATAAAATGTTTTGTTGCTACTTTGGTTCATCAAAAAACTTCAGCA
CACGTGTATTATATGAATCACTATCGCTCTATCTCGCAAAGAGACTCAGAAAGTGAGGAT
GAGAGTGAGAACTCCCACTAAA


invisible?    
Gene introns: 0  

>28692 183 834     14q21.1    chr14:39031384-39031202 BLAT!
TACTGTGCCAGCAGATGTTTTAACAGACTGTGCAGGTGGACCTACAGATCAGTAGATGAC
ACTTGCAGGTAAGAGCCAGCTGTGATGGAAGCAGTAGGATATATGTCTGACTTCTGTTAA
CTTGTAGAAGTGTTCAGGTGTCCCTGGTGATGGAATGGGCTGTGAAATGCTCAGTGGTCT
TTC


invisible?    
Gene introns: 0  

>22916 197 833     2q14.2    chr2:120183403-120183599 BLAT!
CACCCAACACTTTGTGGAAAAAACAATACAGGACTACAGGCTGAGGATGATGGGCAAGTG
CTGGCTGAAGGTCTGAAGTCCATCCCCTTACCCTATTCTCCTGGGGAGGCCACCCTGCCC
CCAGTGAATTCCCCGAGAGATCCCAGTTTCCCGTATTGCTCCTCCCAGACCCTTTGACCC
AGACTGCTTTCCTTGTA


invisible?    
Gene introns: 0  

>32660 182 833     3q27.3    chr3:187015149-187014968 BLAT!
TTTGCAAGCAGAAACACTCAGATATACTAACAACAGTCACATGGGTATAACAGTTATGAG
CAGATGAACCATATTCATAAATAAATAAATCAAAAAGCAAAATATAAAAATGTATATCAC
ACTGTGGTTGGTAATTGTGTGCCCCCAGCTTTATACAGCAGTCATCTGAAATGCTGTGAT
TC


invisible?    
Gene introns: 0  

>5068 220 831     6p24.2    chr6:11387802-11388021 BLAT!
AGGCGTGAGCCACCGCGCCCGGCCTCTCTTCTTTCTTTCATACTCAGTTTTCCTAAGAAA
TTTGTCTACACTTCATACCTCCACTTCCACACTTTCCATTCCTTCCTTCCTCACTGCATT
CCTTCCATCCTGACATCTGGTCCATGCCTCCAGCTCTCCGCTGAAATCATCTTTGCTAAG
GTCACCCTCAGGAACCTGGATGATAAACCGGTAGACACTA


invisible?    
Gene introns: 0  

>14227 106 831     2q31.3    chr2:181654960-181654884 BLAT!
GGGCTAGGTAGAGAGATATTACAGGCAAAGGGAGAAGCATGGAATAATTAAAGGGGTATG
AAAAAACATGAAGCAGTGGTATCAACGCAGAGTACCTCGGCCGCGA


invisible?    
Gene introns: 0  

>24746 187 831     1q41    chr1:221249392-221249206 BLAT!
ATGAAGAGAAGAAGGAGAGGGAAGGAAAGATCTTGTTAGTGGAGATAGGGAGAGAGGGTG
CTGTAGTGAGAAAGGAGGGCTGGAGGGAGGAATCAAAGGGATCTTTACAATTTAGCTAAG
GACTGAATCAGGCAGTAGGCTTTCCTGGGTAGAAACCCTGGCTGACATTATCCTAAACAA
ATTGATT


invisible?    
Gene introns: 0  

>3682 187 829     14q21.2    chr14:45759528-45759342 BLAT!
GGAGATCCTCCTTTGTCAGGATGATTTAAAAGCATAATTCGTCGATGAGCATCTCTTATT
TTCCCTTTATTGGCAGTAGGGCTTACACCTAGTATTAATGCTGCTTCCCGTTTTGTCATT
TTGGGTTCAAACCCACCTCTATAATAGCCACCACTGAAGGCAGATTTTGGTAGGCTTTGA
AAAACTT


invisible?    
Gene introns: 0  

Shown 901-930 from 3142 sequences on 31 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs