Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 631-660 from 3142 sequences on 22 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>5978 173 1205     2q33.2    chr2:204468297-204468469 BLAT!
GCAGTAGATACTTTCACTTCATCAGAGGACCTGGGAAAGAGCCGTGCCAACAGAGTTTGG
AATGGAGGCAAAACTAATTTTGGAGAGCTCCAATGTGTGTTGAAAAAGAAAGCAATCAAA
TAATTGTGTTGTATCACATCCTGAATATGGTCTCAGGCCCTCTGCCAGGTAGT


invisible?    
Gene introns: 0  

>11298 198 1204     18q21.2    chr18:49859777-49859580 BLAT!
GAAGAAAAAGAAAGAGTTCATCCTTTCAAGCAGCCTCCAATCTGAACAAAGAAAACAGGT
GTATTTTTTGACCTATAATTTAAAACTCTATTTATGTAATAGCCTCCCCCAACAACAACA
ACAAAATACTGCAGTAGTTTAGAGACAGGAGGGAGTGAGGTGTTCAGGGATGACCTCTTG
GAGATAATATAATAAGAC


invisible?    
Gene introns: 0  

>13994 296 1202     2p24.1    chr2:19703312-19703607 BLAT!
TTGATTGGAATGACACTCAGTGGTGATTGCTTTATGCAACAGTCTCTATTTTGCAATCAA
GTCTTATAAAACGAGATTTTCTGCTAAAGACTGAACAAGGTAAGTGGAAGCATAAAGCTG
AACCGAAAGTCTGGACACAAGGCAAAGAGTTAGGGTGAGATCTAGAGAGTTGAAAATTAT
CTGCATATGTGGCCAATTTGTGTCACTGACTTTCCGGAAAATGGCTCTGTAGAGAGACAG
GGCTAGAACATATAACAAGTTTAAAAGAAAAAGCCCAAGCTACTCTGTTTGGGTAC


invisible?    
Gene introns: 0  

>22753 265 1202     5p15.33    chr5:2107880-2107648 BLAT!
CATCTATCTATTCATCTATCCATCGTCTACCTATCCATCTGTGCTTCTATTCATCTATCC
ATCTATTCATCCATCTATCCATATATACATCTATTCTCTATATATCTGCCTATCTATTCA
TCTACCATCTGTCTACCTCTCCATCTGTCCTTCTATTCATCTATCCATCCATCTCTCCAT
CTATCTATTCATCTATCTATCCATATATACATCTAGCTATCCCTCCATATATCCATCTAT
CTATTCATCTATCCATCGTCTACCT


invisible?    
Gene introns: 0  

>9501 228 1201     7p12.3    chr7:48943082-48942860 BLAT!
TGAAAAACGTCGCTTCAGGAAATTCCTAGTGTATGTTGCCAACTTCGATGAAAAAGATCC
AAGAACTTTTGAAGGCATTGATCCTAAGAAGACCACAATGCGAGATGTGTATAAGAAATT
TGATTTGGGTCAAGACGTTATAGATTTTACTGGTCATGCTCTTGCACTTTACAGAACTGA
TGATTACTTAGATCAACCGTGTTATGAAACCATTAATAGAATTAAACT


invisible?    
Gene introns: 0  

>18140 186 1189     1p36.21    chr1:14223343-14223528 BLAT!
GGAGGGGGCTGAGCACTAAAGGGCGCCTAGGATTTAGTGGGGCAGCAGAGATAGGTTTCT
TGGAGGCAGGGCAAAATTGGGCACAGATGAGACCAATAAAAGCTTTGACCCAATTAGCAG
TAGTGGGAGCATGAAGGTCTGGTGGGGCCATGGGAAGAGCATGTGGTTCTTTCTCATTTA
GTCCCA


invisible?    
Gene introns: 0  

>3759 200 1186     21q21.3    chr21:29788948-29788749 BLAT!
TATTTTTAAAAAGCCTATCAGACCCTAGGACATTGTTAGATACAGTGGGGATAAAATGTG
GGCAAAACTAGCAAGTAAACCCAAACCCAAACCAACCAACCAACCAATAAAACAAACAAA
GCACCCAAACATTGCCTCTGGTAGGGAAAGACTAAAATCAATTAAAAAGCATATGAAACC
ATAAACCATGACTTGAATAA


invisible?    
Gene introns: 0  

>3669 193 1185     17p13.2    chr17:5532611-5532419 BLAT!
CTGTAAGCATCCTGCTTCAGCTAAAACAACAGGCTTGGAGAGGCACGCATCTCTGAGTAG
ATTTACACACTTGAATCAGAAGGGCTTTTGACTAGCTCAGGCTCCAAACAGGAGTGTAGT
GGGGAGATGGGAAAGGGGAAGCTTTCAGAGTGTGGAGAGCTGATTCGGAGGCACGTAGCC
TGGAGAAGATGAG


invisible?    
Gene introns: 0  

>28879 210 1185     3p13    chr3:71700866-71701075 BLAT!
CTTAACCCACTCCGGAGATAACCTGCCTTTTTTTGTGTCAAATAGAAGTCAGGCTCTGCA
GGCTTCCAAGATCATATTACCCTTGCATGGGCATTCCAGACTACCACACCTCCAGGCCCA
TTTCTGATTGGACTTTGACCAGTATTCTCAGTTGCCTGATGTTCTATTTTCTTCATTAGG
GTGGTGGGGAGAAACATCATCCCGAAAAGG


invisible?    
Gene introns: 0  

>31014 249 1185     1q25.2    chr1:176231943-176231695 BLAT!
AGGGCCTGAGAACTGACCCATCTCTGTCCCCAGCAAAACCATACCACTACCTTAACAAAC
ACCTGCAGTTCTTAGGACATTGAGGCACTCACAGACATCGCTGATATTTATTACAGCCAA
AGAAATCACTTGGAGACTACACTACAGCACCAACCTAAAACCAAAGCCAAAACACTCTAC
CTAACTGATACTGTAGGAAACATCTGTGTGAAAAAGTTTCCTCCACAAAAACTACTCCAT
AAAATTGTA


invisible?    
Gene introns: 0  

>3965 237 1182     20q11.22    chr20:34167331-34167095 BLAT!
GATTGAGCGCCGGGCCTTTGGCCACACAGTCCTTGTGGGTTCCCACATTGTCCCCCACAT
GCTGCGATTCACATTTCGGGGTCATGAGGATCCTCCTGAGGAGGAAGGAGAGATGGAGGA
GACAGGGGATATGATGCCCAAGGGACCTCAAGGTTAGGAACCTTCTCCTTCAGGGACACC
AGACAGAAGCCCCTCTGATTCCTGGTGGACGTGGCTCCAGAGGGCCCTCCGATGGGG


invisible?    
Gene introns: FER1L4 (34146506 - 34195484)  

>24595 197 1179     6q21    chr6:110257473-110257277 BLAT!
GAGTGGGTTAAGGGCCCCACTGTTCACCCCTTCCTGGATCCTTCCATTTGCAGCGATCTT
CTCTTACTCCAGGCTCAGCCATGTGACTTGTTTTGGCCAATAGGATAAACTATACACAAT
CGTATAGTAAATGCTATATGAACAAGGACTTCTAAAGGGCTTGTGCAATTGGACCTCTGT
TCCTGCACCTGCCATTT


invisible?    
Gene introns: 0  

>11520 168 1177     1q41    chr1:218981257-218981424 BLAT!
TGCTCAACCACTCTGGAGAATCAACCACTTAATCTCCCACCCCACTGGGAATGGAATATG
CCTGTTGGCTGTATGGAATCGATATAGGAAAGGATATGGTGGTTTAATACTTTATTTATT
TATTTTTTCAGAATCTAAACCAGTCCTTCTGTATTCAGACCCACTGTT


invisible?    
Gene introns: 0  

>12205 175 1176     13q31.3    chr13:91188101-91187927 BLAT!
CAATCTGTGCCACTACAGCTGGAAAGGATCAGGCTTTAATTACAACCAGGAAAAACTCCA
CAGTGAAACCAATCATGTCCATTTTAGGGTGCACAGACCTTCTCCATGCCTGCTTCACCT
TCACACTTGACTGCTTAGCTCCATTTTTTAACACATGGTGCTAATGAGGCCATGG


invisible?    
Gene introns: 0  

>26202 287 1176     13q31.1    chr13:86928207-86928458 BLAT!
GGTGCCTACCTCATTCCCTTACTTGAACGGCTAGACCTGAAGAAGGACAATATACAAGCA
ATGGTGATTGTTCCCACTAGAGAACTTGCTCTACAGGTCAGTCAAATTTGCATCCAGGTC
AGCAAACACATGGGAGGGGCCAAAGTGATGGCAACCACAGGAGGAACCAATTTACGAGAT
GACATAATGAGGCTTGATGATACAGTGCACGTGGTGATTGCTACCCCTGGGAGAATCCTG
GATCTTATTAAGAAAGGAGTAGCAAAGGTTGATCATGTCCAGATGAT


invisible?    
Gene introns: 0  

>9526 193 1175     16q21    chr16:63056347-63056539 BLAT!
TAAATTCTGTATCAAGTTGTGAAATAAATATATAAATTTATTGCTTCAAAAGAATATCTA
AACTGGTATTGCCATGGGAAGCGAAGGAGGCAGTAATCCATACTAGTTTGTCATCCTGCC
AGATGAATATTTATGTATTTCTCGAGGATGCTGTGTTCTAAGAAGTAAAATATTCACTTC
ACATGCCAGTGTT


invisible?    
Gene introns: 0  

>23323 192 1172     21q22.2    chr21:40556917-40556726 BLAT!
CAGAAAATATTTCTTCATCATGGAACTGTGAAATCAAATTGAAGATCTTACTGGTAAAAA
TGACAAATTAACAAAAGGACTAAGACAAGTGGTGCCCAAACAACCTTTTTATTCTGCAGT
TCCATCATCATAATAGACCAGTTAACCCAGGAGTCCTAATGTTTTAAAACATCATTGTGG
TGATCTTGTTTA


invisible?    
Gene introns: 0  

>25878 240 1172     Xq11.2    chrX:63265092-63264857 BLAT!
TATAATCACCATATCCATAGTAGTTGTTGTAACCAGTGTAGTCATATCCTCCATAACCAC
CGTAACCTTGGCTGTTATATCCATAGTTGCCATAGCCTTGATTCCAATAGTTACTATATC
CCTGGTTCCAGTTTTGACTGGGGCCACCACCTCTTCCACGAGCTCTTCCTGCAAATCCTC
CTCTAGATCCCCACTGTTGCTGTTGCTGATATTGTTCCTTCGACATGGCTACTTTTTTTT


invisible?    
Gene introns: 0  

>26816 296 1171     9q21.33    chr9:89599565-89599860 BLAT!
TGTCTTTTTACATCTCTGAGCAGTGATTCTGTTGGGTTTGGATTTATTTGAGCTTTTGGT
AAAATACAGCACTACTCCTACCTCTCCTTCCCCGCTAAATCTAGGCTCCTAGGAATTTTA
GAAATATCTATAAATTTGCTTAATTGCCAGCCAGTTTCTCCATTTCTAGGCAACTGGCTT
CCCTTAGCTGTAATGTCAGAATCTGACCTATGGCATCAGGGTCTCGTTTATCTGATGACT
ACCAAATGTTAAGGGCGCCGTCAGCCCGCTTTGCATGCCTCTACAACTGGGCATTA


invisible?    
Gene introns: 0  

>14973 249 1170     16q22.3    chr16:73603974-73603726 BLAT!
ATGTATACCCGGGAAGTGTCAGATCACAGGAAAAGAAGACTTTTAATATTCAAGGAATAA
CTGTTTTTTAAGGAAAGCTTGGGAAACTGCCTCGGCAGCCTATTTTTAGGACTTCACGCC
CTCTGCCTTCTCATGGAGGGGGTGATTAAGGGAAACGGGTGGTTGCCCTTTACAGTAAAT
GATCAGTTTGTTCTTTTACTTTCCAAATATGCAGATTAAGATAATAAAGAAGCGACAGTG
GGTTCCTTG


invisible?    
Gene introns: 0  

>30047 175 1170     20p11.23    chr20:20827446-20827272 BLAT!
CCTGAAGGAGGAGGAGGGCTTTTCCACCCCATGCCATTCCTTCCTCTAGCTCTGGGGAGG
TGGTTGAGTATATCTGTCAGCTGCCACATATCAAAGAATGTCACCCCCGAGGGAGCAGGG
GCTCAAACAGTCAAGGTAATTTACATTTTAAACAATTATAGGCTGGGCACAGTGG


invisible?    
Gene introns: 0  

>23158 242 1168     3q13.32    chr3:117388733-117388492 BLAT!
CTGTGAGCAAGTCTCTTCCTTCAGCTAACTGGAATTACCACATCATTTCACTCCACCGGG
TTTTCTTGACTTGGCAGTTTTCTGATTGCCTGGCGGTCACAGACCATATTCTATCTATTG
CTGATACAGGGACCTAGAAATGAGGGAATTGAAAATGCACAAGGCTGTTACCAGGACCCC
AGCTCAGAGCTGTCCCTGAACTGAGATTTTTGTTGTTGTTGCTTACATAGAGAATCAGTC
TC


invisible?    
Gene introns: 0  

>22153 234 1165     16p12.3    chr16:16881298-16881065 BLAT!
CAGCACCATTAGTTATTAATAAAACCAGAATGAAACACCACTACTCACCTATCAGAATGC
CCTCCTTAAAAACTGACAATATCGTATGTTGTTAAGAAGGTAAAGTAACCATAACTCTCA
TGCATGTGAATGGGAATGCAAAATGTCACAGCCACTTTAACATTTTGGCAATTTCTTATA
GAGCCTAGCATACACTTACCATATGATTCAGCATCCTCACTCCCAGACATTTAC


invisible?    
Gene introns: 0  

>10985 232 1162     2q14.3    chr2:127519199-127518968 BLAT!
CCCAGAAGCACAAGCATTTCAGTTTTTCTGTAGTAATCTGTCATTAATGGGGCCTGCAAA
TTCCCGTGTCCACACATGTGAGCAAGAAAAATGGAATGTGCCCCCTAAGCATGAACTCGG
CCCACTATGCCCTTGGCTTCTGTGCAGCTGTCCATGCCCAGAGCCTCCATGACAGCGGCC
TAGTCATTCCTCTCCAGGAGCCTGGTCTGGTTTCAGGGGCAGGGGCTTTTTT


invisible?    
Gene introns: 0  

>10181 223 1161     17q24.3    chr17:68564115-68564337 BLAT!
ACATAAGTCCAAAGCACTGGATGTTTCAAGCATGAAATAACAATAATAGAAAAATATTCT
AATCCAGTCATTAACACCTTTAGGTGTTCAGTCAGTTAGATTAGCATTTCATTCATATAG
GCTGTTTTTAGAGTCTCAAAATTAATCTATGAGTAATAATAATATCCTAAAGACAAACAT
ATATAGATTGACTTTCAAGTTTTTGGCAAGAGAAGACCTCAGA


invisible?    
Gene introns: 0  

>4641 165 1154     8q24.22    chr8:135172195-135172031 BLAT!
TAAAATGTCATCTAGGGAATCCTGGGGAACTGCAGAGATCCAGGAATCCTACTCTACACT
ATATTTATTATCTCTATGAATTTTGTAAGAAGATGTGCACACAGAAAACAGAAATATATA
GGGGGACAAAAGGTTCTACTTTATTAGAATTCTGGGAGGCTGGTC


invisible?    
Gene introns: 0  

>13750 221 1152     7q31.31    chr7:120985823-120985603 BLAT!
TGATGGTTGGGCTATGGTTAGAAATATGTTGGGTTAGTGGAGAAGGCAGTATTCCCTGAG
AGTTGTGGTTTTCAGTGGGTAGAAGTGGGAGAGTCAATTGGTGAAGATTTCCTTAGGTGT
AAGGAATGAGCAAGAACTGGGCCTTATGTCCTGCCTCCTTCTTACCTGGGGAGTGCAGCC
TGCCCCAAATGGCTTCCTGTTCTCCCTTAGGGAAAGGACTT


invisible?    
Gene introns: 0  

>22962 171 1150     11p15.1    chr11:19934048-19934218 BLAT!
GTCACTGTTGATCTTTGTGTCCCCATAACTGGCACAAAACAGAGATGCATTAAATGAAGG
AATGCATTCTTTAGAGTTCATGTCGAATACTCATTGTCATGAAGACCGTCCTTTAGTGTA
ACTGGAAACCCTTACCCTTGGGACCATGTCCTTATAGGCATGTTTCTTCTT


invisible?    
Gene introns: NAV2 (19734880 - 20143147)  

>32919 256 1149     6q25.3    chr6:160068416-160068161 BLAT!
CCCAGCTAATTTTTTGTATTTTTAGTAGAGATGGGGTTTTGCTATGTTGGCCAGGCTTCA
TCTCTCTCTCTTTTTTTTCTTCCTCTTCCCCTTCATTTTCCTCTTCCTCTCTTTTTCCTT
CTCCTGGTGGATCAACATGAAATTTTTTTCCTTAAATTGCAATGTAAGGGTCAGCTGTGT
TCCTGAGAGTTGAGAGAGAAGATTATGAAAGATTATTTAAAGTGTGACTTGTGTGATTTC
TAAAGCTGTGTTCATT


invisible?    
Gene introns: 0  

>31328 201 1148     3p26.2    chr3:3808078-3808278 BLAT!
TTGGTGCAGACTTTTTCTTGGCTGTCCATAAATAGCCAATCTCAATGCAGCCATCCAGGC
AGTCATTTCCAACTCATCAGACCTGGTATATAAGAAGAAATCTGCTTCATGTATTTCTGC
ATAAGGACATAGTATAATCTTTCCCCTGTAGGAGATGAAAACCTAAAACAACCTCAAGCT
TAGGGATTTTAACACCATTCA


invisible?    
Gene introns: 0  

Shown 631-660 from 3142 sequences on 22 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs