Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1381-1410 from 3142 sequences on 47 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>24834 184 564     9p21.1    chr9:31284338-31284521 BLAT!
ACATAGCTTTATAGATATTTGCAAACATTACGTGAATGTTAAATATCAAAGTATTAATGA
TCCACTGTATCTGACATACTGATGTATATTTAGCAATTAAGTTAATTTCTGTTTCTTTGT
TTTTACATAATTACAAATGATTTAATGTCAGAATTTCCTGAGGATTTTTCCTAATCAACA
TGGT


invisible?    
Gene introns: 0  

>9995 153 563     7p14.3    chr7:32446928-32447080 BLAT!
AATTGTGTTATATCCAAATTTTATCATTTCTGAATTTCAGCTAGACAGAGGGAAGAACAG
CCTCCAATCAAAACACTGCATGGGAGATAACTTGGATGAGAAGAAGAAGCATGAGCCAGT
ATTGCACAGGCCTCTTTGTCATGTTTGCCTTCC


invisible?    
Gene introns: 0  

>5838 164 562     Xq27.2    chrX:140842200-140842041 BLAT!
GGAGATGGAGGTTGCAGTGAACCGAGATCGCCCCAATGCACTCCAGCCTGGGCAACAGGG
CAAGACTCTATCTATCTTAAAGAAAAAAGCTCACTTACTTCCTAACTATGCAATTGGCCA
CAAGGGACCTTTCTCCACATCATGTGTCTGAGGAATGACTACAC


invisible?    
Gene introns: 0  

>22380 174 562     14q23.2    chr14:62530164-62529991 BLAT!
TTGAGAAGACTAAATGAGATAAGCCACGTAAAGGCCTTAGCATATGTCTGGCATATGGTA
TACTTTTTAAATGTTTAACTACTATTGTTATATTCATCGTCTTCATCAGCATCCCCCATC
ATGTCACTGCCCTTTGTGGAAATCCTTTTCTCCAGCTTGGCATTTATACGCACA


invisible?    
Gene introns: SYT16 (62462540 - 62568427)  

>31100 168 562     5q31.3    chr5:141436702-141436535 BLAT!
TGCTCCCAGTGCAGGGAATTGGGAGTATCCATGAAATTGAATATTTCTGCTTTTGACAAG
TAAATTTAAACAAAATTGTGGATTAGTTTCAGTCCACTGCTGCCTGTCCCTTTTGAGTTG
ATAAGACCGGTCCTTTACCCCCAGCAAAATAGCTGAGCGAGTAAAAAA


invisible?    
Gene introns: 0  

>2846 153 561     12q23.1    chr12:96996552-96996705 BLAT!
GCAACCCCTGCTTTTTTTGCTTTCTGTTTGCTTGGTAGATCTTCCTTTATCCCTTTATTT
TGGGACTATGTGTGTCTTTGCATGTAAGATGGGTCTCCTGAATACAGCACACCAATGGGT
CTTGACTCTTTATCCAATTTGCCAGTCTGTGTC


invisible?    
Gene introns: 0  

>13254 180 561     17q22    chr17:50304589-50304768 BLAT!
CATTGATGAGAATTAGTATATGGGATGCTGTGTAAGGGTGGCTGGGATGTGTAATATTCA
GCTGTGGAAGGAACTTATTACTTAAAGGAAGAAGGAGAGAATGGGTATTGTGGGACAGTT
ATCAGTTTCTGCCATGGGTTTGTAGACTGATATTGTAGAGAAATAAGTGCGCTTTATCCT


invisible?    
Gene introns: 0  

>6900 191 560     Xp21.1    chrX:31776047-31776237 BLAT!
ACTTCTGAAGGGTCATTCCAGCTTAAGAACTCCCTGAACGGTCAGCTGAGGCCCTTACTA
AGACTGCGTCAGAGCTCAACTTCTCCCTCTGCCCCTACACGTTGACCCCAAGAACACTCC
TAAATAGACATACTGCATGCTCACCTCAATCTCAGGGTATGCTTCCCAGTCACCCAAACT
ATGATATTATC


invisible?    
Gene introns: DMD (31137344 - 33229673)  

>3746 143 559     12q21.31    chr12:80572883-80572741 BLAT!
GCCCCCATCACAATAAAAACCAAGCCAGTCTCCTTTCCCCTGCTTTCACAAACTATTTTC
AGACCTGCCTGAGAGCCTGCCTTACTCTTCTTAGAAAGCTTCAATGTGTCAGTAATAAAC
CACAACAGTTTCAATATTATATT


invisible?    
Gene introns: 0  

>8585 187 559     4q28.1    chr4:124022041-124021855 BLAT!
ATGTGAAAAGTAGGAGAAACTTAGAGGAGCTAATTTTGGAGGATAACTTCTATATCTGGT
ATATATTGTGCCTCAGTTGCTGAAACTTAAATCAAATTAACTGCACAAGCCCAAGGCGTG
AAAACTATTATTTAGCAGACTTTGAAGAAAGACCTGGGCTTTTCACCTTTGTTGTTGCTC
CTGATGA


invisible?    
Gene introns: SPATA5 (123844224 - 124240604)  

>10893 108 559     6p22.1    chr6:27162398-27162504 BLAT!
TACAAGACAAAGGGGCAGGGTAAGGAGTGTGGGTCATCTCAAATGATTGACAAGGTCAAG
CAAGTCACATGTCCACGTGACAGGGGGCCCTTCCCTTTGTGGTAGCCG


invisible?    
Gene introns: 0  

>16594 149 559     11q22.3    chr11:102916906-102917054 BLAT!
ATTATTTTAAGAAAAGGCTTTTCATGAGTTTTAGCAGGATCTTTAAATAAAGTTACCACA
TTATAAGCACAAAAAAGTTTTTTTCTTTGTCTTTACATATAAAGACAAAAAGGGAAGCAT
GTTTTACATAGACAGCCATAAAAGACAAA


invisible?    
Gene introns: 0  

>17338 149 559     7q33    chr7:133869624-133869476 BLAT!
CCTTCACATGCCATTTATGCTTAATGAAAAAGATGTTGATTTTCAAACCCTGGAGGGTGA
TTTGGGCTGAGACTGAATTAAGTTAAGCATTTGGAAAATTAAAGTTAAAAAAAATACAGT
GTATATCACAGTATAATAAGTGGCAAAGA


invisible?    
Gene introns: LRGUK (133812104 - 133948933)  

>17353 145 559     1p12    chr1:119263443-119263587 BLAT!
GAAGTTGCCAGCAGAGTATGGACACCTGGAACAGATAGGGGAAACAGGAAAAGGGGCAGC
CATCCTTCTACAACTAACACTGCTCTGAGAGACTGGTAAAAGGCACAAATTCTTCAAATG
CACAGACACCAATACAATAATTCAA


invisible?    
Gene introns: 0  

>26371 181 558     3p21.31    chr3:44566531-44566711 BLAT!
AAGCCAGTTCCTCTCTGTGTTAGAGGAACCGCTGGTGCATTTCAATTCCTTTACTGAACC
AACCATATTTGAAGCAGTAGAATGAGTCAAGAAGAGACAAACGCCGGAGAGTAACCAGCT
GACCAACAAGGTGGGTGGGAAAGAGACTCACAGACATTCCTTGAATGGGGAAAAGAGCCT
G


invisible?    
Gene introns: 0  

>29035 193 558     11q14.3    chr11:90848125-90848318 BLAT!
CCTCACTTTCTTCTTGATTATAGGCAACTTCTTGGTATCTACAAAGACTGTATTTTCCCC
TGTTGCATATTTTGCATACATCACACCATTCCATTCCCCTTCAATTGAGCAAAAAGACTT
CTTGTCATTTGGAGAAAAAATCTCGGCAGTAATTCTGTGCTTCTTGCCCCCATAGAAGGG
TTTAGTGTGGAAG


invisible?    
Gene introns: 0  

>3376 180 557     5q21.3    chr5:105354291-105354470 BLAT!
TTGCCCAGGCTGGTCTCAAACTCCTGAGCTCAGGCAATCCACCTGCCTCAGCCTCCCAAA
GTGCTAGAATTACAGGCATGAGCCACAGCACCTGGCCTATATCCTATTGTTATTAAATAT
AAGATGAATTTGCATAGTATTAGGAAAGGTTAGATTAATTTGAAGGGTGACAATTACTTC


invisible?    
Gene introns: 0  

>9389 171 557     10q21.1    chr10:55524453-55524283 BLAT!
AGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCGTTACCATTCAGGATGCAGGC
ATGGGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGCCAAAGTTGAC
AAATGGGATCTAATTAAACTCAAGAGCTTCTGCACAGCAAAAGAAACTACC


invisible?    
Gene introns: 0  

>19307 130 557     8q24.13    chr8:126858958-126858830 BLAT!
GACTATACTGCATATTGTAGGCAATTGTAACACAATGGTTAAGTATTTGGGTATTAAAAC
ATAGAAAAGATACAGTAAAAATAGAATTTAAGGCCAGGTGTGGTGGCTCACACCTGTAAT
CCCAGCACTT


invisible?    
Gene introns: 0  

>9233 126 556     2q31.3    chr2:181644051-181644176 BLAT!
AGTCTGAAGAAGAGGAATATGGAAACAAAAATTATTTGGTATAAAAACACAACTATCATT
TAATCTAAGATTTATGAGAGCCAAAGCATACAAATTCATTCCTTCAGTTCTTCTTTGAAA
TGTTTC


invisible?    
Gene introns: 0  

>23757 171 556     4q12    chr4:58897088-58896918 BLAT!
GTTCTGGACGCTATGGAATAGAATGCAGAAAGTGTTTTACTACTTACTGCTTTCTAACTT
CGGACTTACACAATTAGTAAGTCAGCAATGAAGATAAGGCACATTTCTTCCTTTTTGGTC
CTTTAAGTTAAACTATGCTTAAAATGTCACAAAAAGTTGATTGTTAGGAAA


invisible?    
Gene introns: 0  

>6082 119 555     6q24.3    chr6:148428617-148428504 BLAT!
GATCGCAGCACTTTGGGAGGCCGAGACGGGTGGATCACGAGGTCAGGAGATCAAGACCAT
CCTGGTTAACATGGTGAAATCCCATCTCTACTAAAAATACAAAAAATTAGCTGGGCGTG


invisible?    
Gene introns: 0  

>31839 173 555     6q21    chr6:105929476-105929304 BLAT!
CACAATGTATGAGCCCATATTCACAGCCAATTCTCAATTACCTGTAACTATGTTCCCACC
TCCACTGCTAACCCAAAGTAATATCTAATTGATTTTGGAAGACATTTCAAATTGCTATAC
CTTCTGCCATGCATTGTGCCTAATTTCATTTTACTACCTTAGCACACTCTGAT


invisible?    
Gene introns: 0  

>14455 106 553     2p12    chr2:76761978-76761873 BLAT!
GAGATATTTTTTCCCAAGCAATCTAAGAAGAGAAAACATCATCCACCTGCTGCCACCACC
CTCTCTCGATACCACATAGGGAAATAAATGGTCTTATTTCTTTTTA


invisible?    
Gene introns: 0  

>32962 119 553     1q31.1    chr1:186604715-186604833 BLAT!
AGCACTTTGGGAGGCCGAGGTGGGCAGATCACTTGAGGTTAGGAGCCTCGAGAACAGCTT
GGCCAACATGGTGAGACCCTGTCTCTACATAAATACAAAAATTAGCCAGGTGTGGCGGG


invisible?    
Gene introns: 0  

>8790 187 552     5p14.3    chr5:18635138-18635324 BLAT!
ATAGAAATCCAGGACACCGAGTTAAAGTTATTTTTCAGATGAACAATAAATAATATGTTA
GTATATGTCATGAAGCCTTTATGATTCTTTTATTTTGGAATATTATCTTGCTTTTATCTG
AAATTCAAATTCAACTGAGTGTCTTGTATTTTCTCTGGCAATGTTACTTAGGATGGATCT
TCAGGAA


invisible?    
Gene introns: 0  

>14584 148 552     18q22.1    chr18:63242251-63242104 BLAT!
AGTTAATACAAGCAAAGCTCTTAGAGCAATGTCTGGTATTTAGACACATTCAATAAATAT
TAGATAATAGTATTGATATTTCCGCTGATACATTATGGAGTTCAGTTATTCACACTGTCT
TGCTCTAAAGTATGTGTATCCCTCCCTA


invisible?    
Gene introns: 0  

>936 144 551     Yq11.21    chrY:13663276-13663365 BLAT!
AAGGGAATCATCCGGAATGGAATGGAATGGAATGGAATGCAAAGCAATGGAATGAACTCG
ATTGAAATGGAATGGAATGGAATGGAATTGAAAGGAATACAATGCAATCAACCCGAGTGG
AATGGAATGGAAAGGACTGGAATG


invisible?    
Gene introns: 0  

>1114 108 551     5q23.3    chr5:128525147-128525228 BLAT!
AGCGGCCGCCCGGGCAGGTACGCGGGGGGAAAAGAATAAAAGACAATGAAGCACACCTAC
AGGACCTAGAAAATTGTCGCAAAAGAACAAATTGAAGAGTTACTGGCT


invisible?    
Gene introns: 0  

>6988 146 551     3q24    chr3:145341560-145341415 BLAT!
GGACCATTTCGGTTACTTGACTGTTGAGAGCTGCCCCTATATTAGGAAAAATATTGTTGA
ACATTCACATGGGAGAAAGCATTATCATTTGCTGGGTCCTTTATGAGAGATGCATCTACA
TAAATTTCTATACAATTCTGTCAGCA


invisible?    
Gene introns: 0  

Shown 1381-1410 from 3142 sequences on 47 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs