Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2161-2190 from 3142 sequences on 73 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>26866 116 320     10q23.1    chr10:85927685-85927570 BLAT!
TGGTTCCCAGCAATGAAAAAATTTAAAACTCTTATAATAAGAGTAATAATAGTAATAGAA
ACCTGCTTACTGCTCCTTTGTCTGATACCTGTATTTCTCCAAATGATAAAAAACTT


invisible?    
Gene introns: 0  

>28637 158 320     2q31.3    chr2:181602398-181602241 BLAT!
CTGGGTTTAAACAAAATGAGAAATAGTGTAATATAACCAGGATAATAATATAATTTATCA
AACAAACTGGGATACTTCTGAGAATAAAGGTGTATCTGTTTTTAATTATACCTGGTCATA
AATATGGTTGAATACTTGAGTTATGAAGTTAAAAAAAA


invisible?    
Gene introns: 0  

>30235 110 320     20q13.32    chr20:57523252-57523361 BLAT!
GCTTCCACAACAGGCAGCACCAAAAGCAGTGACATGAGGACTAAGGACAACTGTGTTGAA
ACTGAGGTCATGATGTTGGAATCTTGAGGGCTGAAGGTTCCAAAGAAATG


invisible?    
Gene introns: 0  

>6998 133 319     8q24.13    chr8:124300928-124300799 BLAT!
TATCCCAGTCTTCATCACTTATCCTAGCAAAGGAATGATCCCTCAGAATTCCAGCATTGT
TGACCACAACATCTATTCTTCCAAAAGCATCCAGGGCTGTCTTCACAACCTTCTCTCCTT
CTTCCACTGAATC


invisible?    
Gene introns: 0  

>15423 108 319     Un_gl0002160    chrUn_gl000216:18249-18340 BLAT!
TTCCATTGCATTCCATTCCATTCCATTCCCCTGCACTCGGGTTGATTCCATTCCATTCCA
CTCCATTCCGTTCCATTCCATTCCATTCCATTGTGTTAATTCCATTCC


invisible?    
Gene introns: 0  

>17076 129 319     1p32.1    chr1:59716985-59717113 BLAT!
GGGTGGAGCCCACCGCAGCTCAAGGAGGCCTGCCTGCCTCTTTAGACTCCACCTCTGGGG
GCAGGGCATAGCCAAACAAAAGGCAGCAGAAACCTCTGCAGACTTAAATGTCCCTGTCTG
ACAGCTTTG


invisible?    
Gene introns: 0  

>17950 144 319     1q32.1    chr1:199466074-199465931 BLAT!
GTTAAGACTTATTTTGTGGCCTAACATGTGGTCTATCTTGGCGAATGTTCCATGTGCTGA
TGAAAAGAATATATATTCTGTAGTTGTTGAGTAAAATGTTCTATAAATGTCTGTTAAGTC
TGTATAGTCTAAAGCACAAATTAA


invisible?    
Gene introns: 0  

>29926 185 319     11q12.1    chr11:56663480-56663664 BLAT!
TTGATGTCTGACTCCAAAATCTAAGCTCTTAACCTCTAGGCTGGGTCCTCCATAGGTTTT
AGAATGACTGAATAAATGAATGAAGGAATTAATGAGCTCATAGAGAGGATTAGGTAGTGT
TATCTACATTTAGGAGAAATTAAGTAATTTCTGTGTGTGAAACAGCCTACTCCTCTGCTA
CCCTA


invisible?    
Gene introns: 0  

>2258 116 318     Un_gl0002200    chrUn_gl000220:161000-161053 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGACGCGATGTGATTTCTGCCCAGTGCTCTGAA
TGTCAAAGTGAAGAAATTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTAC


invisible?    
Gene introns: 0  

>13247 136 318     1q32.3    chr1:214323044-214323179 BLAT!
AATAGTTGAATAAATAAAGAAATGTGGGAGAAAAGATAGATCTCCCATGCAGAAGAATTT
CAAATAATTTGTGTAGATATACCACCCTCAAAGAGAGGGAGCAAAGCCTTCCCACTCTTT
CAGTATGGGCACAGAG


invisible?    
Gene introns: 0  

>19788 117 318     9p13.3    chr9:35149004-35149120 BLAT!
TTCCTTGCTCCAGACAGGTGATCAGGTCTGGCTTAGTGACAACAATACCAAGGAAGACCA
GGTGTCTGTAGTTCTCTAACATCACATCCCTATATAAATTCTGCTGTGCAGTGTCCA


invisible?    
Gene introns: 0  

>21302 136 318     2q12.3    chr2:108273501-108273366 BLAT!
TGTAAAATATGCACAAAATGAAATGCTAAACTATTAAGTGTATATTTTCTGAGTTTTGAA
AATGTTTCCACCTGTGTAACCAAAATCTATATTATGACATAGAACAGGAGTCAGCACCTG
TTTCTTATAAAAATCC


invisible?    
Gene introns: 0  

>23731 111 318     2p24.3    chr2:14816514-14816624 BLAT!
GCTGAGGAGTGCCACCTGGCTATAGATCTCAGGGGTTCTCTTCTCTAGGATTTTCAACCC
AGGAGATCTCTTCTACACAGAGCTTTTGTGATATCTGTCACACACACACAA


invisible?    
Gene introns: 0  

>29900 118 318     3p24.3    chr3:23830854-23830737 BLAT!
TTCGTAACCACCCCACAAGGTAGAAACTAAATTCCTGATTTACAGATGAGGAAACTGGGA
CATAGAGAGGTAAGGGATCTGAAATCACAGCTGATCAGTTTTAGAGTTGAAATTCTAA


invisible?    
Gene introns: 0  

>9561 158 317     2q31.3    chr2:181355978-181355821 BLAT!
TAGCATTTAATACCTACATTAAAAAACTAGAAAGATCACAAATAAACAACCTAACATCAC
ACCTCAAGAAACTACAAAAACAAGAACAAACCATACCCCAAATTAGCTGAGCAAAAGCAA
TAACAAAGATCAGAGCAGAACAAAATGAATATGGACCA


invisible?    
Gene introns: 0  

>13901 151 317     7q11.22    chr7:67264799-67264649 BLAT!
ATGAAGGAAGTCTTGGAAGCAGCTCTTGGTTTTTGGTAAGTGGACTCAGTATAGACTAAG
AATGTTGATAAGAAACTAGTAGGAAGAACAGGCAAGAGTGCAGATTTCTTCATCCCATCA
CTTCTACGGAAGTGAGATTTTAAGGGTGGAG


invisible?    
Gene introns: 0  

>14983 151 317     6p25.3    chr6:1288224-1288074 BLAT!
GATTGACTAATAAGTCCTGCTTCATTTTTATGACAGAATGCTACTACTAATAGCAGTGTT
CTAGATTTTCATCCACCATCATGGATAAAGCTCTCCGTCATGTGGATGGGTAAGAAAACA
TGGAGTGGAAAATGACATCTATACTGTGCCC


invisible?    
Gene introns: 0  

>19875 136 317     12p13.33    chr12:1762520-1762655 BLAT!
CTGGGCGACAGAGCAAGGCTCTGTCTCAAAAAAAAATTGTAAATTTAAAAAAAAGTTGGG
TGGTGTGTCCTTGCGGATTGATGGCAGAAAACAGAATCTGGAGAGCAGCAAAGCTGAGTT
CTAGATTTTTCATTTG


invisible?    
Gene introns: 0  

>24391 155 317     6p22.3    chr6:18671620-18671466 BLAT!
AGCATTGGAAGTTACTGGATGGTTACAAAAAGCGGAGAGACGACACGATAGGATTTATAT
TTTTAAACAGCACTTTGGCTACTAGAAGATAAATGATAAGGAAGGTAACCGTCTATGCCA
GGAGACCAGCTAGGTGACAACTGTAATAGATGAGG


invisible?    
Gene introns: 0  

>25235 134 317     17q24.3    chr17:69292078-69292211 BLAT!
CAGTTCTTACAGGAACTAAGAGTGAAAACTCACTCATTCCCATGAGACTGGCACCAAGCC
ATTCACGAGGGATCTGCTTCCATGACCCATACACCTCCCACCAGGACCCCACCTCTGACA
CTGGGGATAACATT


invisible?    
Gene introns: 0  

>32152 148 317     4q34.3    chr4:181145690-181145543 BLAT!
AACAATTATCAGCTAAGAATTTCGTATCCAGTGAAACTAAACTTCATATATGAAGGAAAG
ATACAGTCTTTTTCAGACAAACCAGTGCTTACAGAATTTTCCTCTACCAAGCCACCACTA
CAGGAACTGCTAAAAAGAGCTCTAAATC


invisible?    
Gene introns: 0  

>326 111 316     Xp22.31    chrX:6443972-6443862 BLAT!
AGAGAACAAGATCTTGCTGTATTACCAAGCTCATCTTAAACTGAACTCCGGGCCTCAAGA
GATCCTCCCAACTTGGCCTCCCAAAGTGCTGGAATTACAGGTGTGAGCCAC


invisible?    
Gene introns: 0  

>4954 180 316     15q13.3    chr15:31429264-31429085 BLAT!
CACTAATGCAAAAGAGAGCAGAACTTCTCAGGACTCCATGAGGAAGACAGGGACCTCCCC
AAAAGGTAGAGCGAGCAGGGCCTTCCCTGTGCTCCTGCAGGGGTCTCAGGGTTGTCAGAT
CTGTCTCTTTCAGGTTCCTTCCTTGGTTGCCAGATCTGTCAAAAGAAGAAATTACAGCAA


invisible?    
Gene introns: 0  

>11949 167 316     5q21.3    chr5:109598941-109599107 BLAT!
GTGTGGTGGTAGAGTGTGTGTGTGTCTTTGTGTGAATGTGTTTGTGGTATATTTACAGTG
ATGGTGGCATTTCAAGTCGTTCAACAGCAAGGTCTTGCTGAAACTTATTATTGCAAAAAT
AGCAGTGTCAGTATTCAGGGCTATAGAAGGTCTAGAGAAGGATTGAT


invisible?    
Gene introns: 0  

>13525 139 316     5p14.1    chr5:28862211-28862073 BLAT!
TTTGATTAGTAATAATTATTCTCGGACTTAAAGAGAGGTTTACTTGGATGTGGAATGTCA
TGAAAGTGAAATCTGTAGCAAGGCACACCAGAGGAACTGAAGAAAAGAATAGGCACTGAG
GACTTAAGCAGGAAGTATA


invisible?    
Gene introns: 0  

>13824 129 316     1q25.3    chr1:185479324-185479452 BLAT!
TGTGCTAAGAAAAACTGACATAGGTAGCTCATCAGTTGTGACATGTCTACCATGAGGAAT
GTTTTCTTGGAACATGATCTCAAGTTATCTACTTCTGGGACTGTTAAGTTAAATACCTGA
GAGATTCTT


invisible?    
Gene introns: 0  

>30472 110 316     9q32    chr9:117361971-117362080 BLAT!
TAATTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGCTGGCCAGGATGGTCACAATC
TCTTGACCTCATGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGATTAC


invisible?    
Gene introns: 0  

>10818 129 315     1p34.3    chr1:38990482-38990354 BLAT!
AAGTGGGTCAAAGACCTAAACATAAGAATTAAAATAATAAAATTCATTGAAGAAACATAG
AGGAAAACCTTCATGACATTGGATTTGATGATGATTTCTTGGATACGACACAAAAGGCAC
AGCATCAAA


invisible?    
Gene introns: 0  

>15194 132 315     1q31.1    chr1:189990397-189990266 BLAT!
TTAACACTTGAAACAAATGTGTGTAGCTGGCCTGTTTGACCAATGTCATTATTATTTTAA
AAGATTCTATAGAGAATGCCTCATTACTCATATTGCCTCCACCTGGTGCAGACTACTCTC
ACTGTCCCACCC


invisible?    
Gene introns: 0  

>15218 129 315     20p11.22    chr20:21735481-21735353 BLAT!
GCTAATTTCTTTATTTTTATTTCCTTGTAGAGATGTGGGTTTCACCATGTTGCCCAGGCT
GGTCTTGAACTACTGGCCTCAAGTGATCCTCCCACCTCGGCCTCCCAAAGTGCTAGGATT
ACAGGTGTG


invisible?    
Gene introns: 0  

Shown 2161-2190 from 3142 sequences on 73 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs