Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 241-270 from 3142 sequences on 9 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>21871 355 2666     18q21.32    chr18:58910793-58911147 BLAT!
TCAATGCTCATTCCCAGACTCATCTCTTAGAGATTCTGCTTCTAAATGTCTGGCTGAAGG
CCAGGCATCTGGATTTCTTCTGGAAGATCTGAGGCAGGTCATCCATAAGTTGTCTTTTGA
GAAACATGGTTTTAGAGAAATGGGCAAGAATGACTAAAAGAATCCGTGTCTACCCGAGAA
TAGTTGCCTTACCTGGAATTACGATAATTTTACAGCTTTCTCCCTCTCTCTTTGTATACA
TAGAGAGAGAGGTAGAACTATCCAGGCTGACCAGCCAGGAATGGTAAGAGATTTCACTTA
CAGATGAGTTAGCCATATGTGACTTCTCAGTATCAATCTGATTCTGATCTAGAGT


invisible?    
Gene introns: 0  

>32741 315 2666     6q21    chr6:108326381-108326658 BLAT!
CGATGACGTCGATCATCTCATCCTGCCCAAACACTTGGTAAAGGCCTTCTTCTTAGATTT
ATGCCAATTCTTATAGAAACGCCTCTTGCATTCATCACTGATGTGCTCAGCAAAGACAGT
CTTGAAGGTCCGGAGGCCTCGAGGGGTTTCCACGTAGCCCACAATGCCCACAACCACCAT
GGGTGGTGTCTCTACAATGGTCACAGCCTCCACCACCTCCTTCTTGTTCACCTTGGATCC
CGGCCTGTCGACTTCCCGCACGATGTGAGTCATGCCAGCCTTGTATCCCAGGAAGGCTGT
GAGGTGGACCGGCTT


invisible?    
Gene introns: 0  

>22883 343 2653     20p11.22    chr20:21468834-21469176 BLAT!
ATGCAGTTATCAATGCTTAGTTCTTCTTGGTTTTCTTCAGATAGTGAGCCCGTGTAGACT
TGTTCATATTCATGACTATTTTCAAATAAATCCAAGAAGGCAGGTTTGAGATTATCGAGC
CCATAAGAGCATGGATCAGGTATCCATTGGTTCGGGATTGCAGGCCGACTGTTTTAATTG
CAGACTTCACAAACGTCTCCGGAGAGGGCTTATCCAAAGTTGGCTTCCGGATTTTAGCCA
GTTTTGTAGCTACGAAGTATGGCAGGACACTCTGCACAAAGACGCCCTTGCTCCTATACT
CCTCATGGAGGCACTGAGAGAAGAAATCTACAAAAGTCTTGGT


invisible?    
Gene introns: 0  

>27199 187 2646     12q24.31    chr12:121031766-121031933 BLAT!
GAGCGGCCGCCCGGGCAGGTACATTTCACTGAAAACTTTTTATTGCTCTTTTGGATAGAA
ACGGGAATTTATTTGCCAGGAAGGATGATCCCATCATACTTCTGCTGGAACCAGCGCATG
GCCTCCTCTTTGCTGATTCTGTGTTTGGCCCCAATGCAGCCTGTCCTGCGCTTCTTGTCT
GCGATGC


invisible?    
Gene introns: 0  

>14806 256 2643     4q31.22    chr4:147057075-147057330 BLAT!
ACAAAGTTCACTGGGCATTTTTTGGCAAGGAAAGGCATTAAAATAAAAAGAAAGACTGAC
AAGAAGGAAGAAACACTGATGAAATGCAAGAAGACTTCCTAGAGCCTGCTCTGCTGTTAC
ATTCTGTCATGAACTAGAGATGATGAAGCTTTCATTCACAGAAATGAATGAGCATTGCAG
ACTTGTTGCAGCTGACCTTGCTAAGTTAAACTCAATTTGCTTTTCAGTTAAACTCAGTAA
GCAGTAGCAAATTTTG


invisible?    
Gene introns: 0  

>3045 343 2638     7q34    chr7:143010059-143009722 BLAT!
TTTTGAGGATGACCGGTGCCTTGCTTTCCATGACATTTCCCCTCAAGCACCAACACATTT
TCTGGTGATACCCAAGAAACATATATCCCAGATTTCTGTGGCAGAAGATGATGATGAAAG
TCTTCTTGGACACTTAATGATTGTTGGCAAGAAATGTGCTGCTGATCTGGGCCTGAATAA
GGGTTATCGAATGGTGGTGAATGAAGGTTCAGATGGTGGACAGTCTGTCTATCACGTTCA
TCTCCATGTTCTTGGAGGTCGGCAAATGCATTGGCCTCCTGGTTAAGCACGTTTTGGGGA
TAATTTTCTCTTCTTTAGGCAATGATTAAGTTAGGCAATTTCC


invisible?    
Gene introns: 0  

>4404 237 2636     2q31.3    chr2:181752184-181752420 BLAT!
AACCAAAAAGTCTCCTGAATAGCTAAAGCAATTCTGAGTGAAAAGAGCAAAGCTGGAGGC
ATCACACTATCTGACATCAAAGTATATTACAAGCCTATAGTATCCAAACAGGATGATACT
GATGTGAAAACAGACACATACACCAATGGAACAGAAATGAGGATCCAGAAATGAATCCAT
GTATTTACATCCAACTGATTTTCAACAAAGGTGCCAAAAACACACACTAGGAAAAGG


invisible?    
Gene introns: 0  

>16443 222 2634     16q12.1    chr16:51795529-51795308 BLAT!
AATTGCCAGTGCAATTGCTTCACCATGCCAAGTGGCTCCATTAGTTAGGGTTCAGTATGT
ATTTAATGTTGCCATAAAATCTGTCTTCTCAAAGTAAACAAGGCAAGTCTGTGAGCATCT
CCGACAAGATGTATGAAGCTTTGTTTGGGATAATGGATTTGACATGAGTAAAAACACTGG
GGATTAAATGGACCCAGCACGGATAAATATGACTAATCGTCA


invisible?    
Gene introns: 0  

>11418 309 2627     4q21.1    chr4:77266748-77266440 BLAT!
GCATATCAGTTATTCTTGAACAAGTCAATACAGCTCTGCAAAGGGGAGACATTGTTCCTG
GCATGTTTTATTTCCAGTTCAGACATTTCAATTAGATTCTTTCTAAATGCTGCCACTCTC
TTCCGTTTGAAATTTATCAGTTCTTCTTTTGCAGATTCGGAAAGTTGTTCAAATTTCTGG
CAGCACTCCTGCTGGTGTGCCTCAGCCAACTTGACGTCTTTGCTCTTTAACCGGGCCTTA
TCCAGAGCTTTGTTTGAGTTCTCATAGTCAATGAGGGCTTTGGTGCGTCTGTATAAGAGA
TCCTTAGCA


invisible?    
Gene introns: CCDC158 (77234191 - 77328458)  

>7530 317 2623     9q22.31    chr9:94473727-94473409 BLAT!
CACCGCTCACATATCACACACGCCACATACACATCACAGATAACACACACACCTTGCACA
CCTCGCACACAAATTACACACACACACCACACATACAGCACACACATGTGCACACACACA
AACACTCCAGAAACACCACACATCACATACACAACTCACACACCATCCACACATACACCA
CACACCTCACACAACCTCACACATACCACAAACACCACACACACACCTCACATACCACAC
ACATACACCACACACATCACACACCACACACCGCAAACATGCACCACACACACCTCACAT
ACTACACACATCACACA


invisible?    
Gene introns: 0  

>14854 343 2612     9p12    chr9:43313774-43314088 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCAGGGCTCCCAAGATTGATAATTAGGAAAGTTGATAA
GCAGACCGCATTATTGGATGCAGATGATCCTGTGTCACAACTCCATAAATGTGCATTTTA
CCTTAAGGATACAGAAAGAATGTATTTGTGCCTTTCTCAAGAAAGAATAATTCAATTTCA
GGCCACTCCATGTCCAAAAGAACCAAATAAAGAGATGATAAATGATGGCGCTTCCTGGAC
AATCATTAGCACAGATAAGGCAGAGTATACATTTTATGAGGGAATGGGCCCTGTCCTTGC
CCCAGTCACTCCTGTGCCTGTGGTAGAGAGCCTTCAGTTGAAT


invisible?    
Gene introns: 0  

>28335 307 2607     5q12.1    chr5:60705274-60704968 BLAT!
ATATAATTAATCTTGCCAATTTTCCACATAATTTCTCTCCTTTTTTGATCTTTTGCTTTA
CAAAATCATGCTTGAAAACTTTTACAATTTCTTTCTGGTAGCAATTCTGAAATGAAAATG
GACTGCAGGTAAGTAAATTTGAGAACCTCCTTAAACAGCAAAAATCACCTCCCTAGCCCC
TCCACTGGTAAAAATCACCAAAGTTTTTACTGTGGCCCCCTCGTTCTCAGAAACAAAAAC
AAAAACAAAATGGCCTTTGAAGTTGGACAATTTGGTATGTGTTACATTTAATTTTGTGCT
TATACTT


invisible?    
Gene introns: ZSWIM6 (60628099 - 60841999)  

>11183 195 2606     8p22    chr8:17083900-17083706 BLAT!
TGTTTGTGTGAAAAGACATTTTCAAAGATGAAATACGTGAAATCCCATTACACATCAGCA
TTAACAGATTAACATTTTCTATTTATTCCAATGAGGGGATACCAACTTTCAGCCCAAATT
GAGCAAAATGTTACCTCCCGTCCCCTGCCAAAAAATCCCATTATTCCCATTAGTAGAACT
CTATTACTAAAAAAA


invisible?    
Gene introns: 0  

>26274 304 2597     2q31.1    chr2:177065912-177065609 BLAT!
CACGGAGGATAAGATCAATGCCCTCATTAAAGCAGCCGGTGTAAATGTTGAGCCTTTTTG
GCCTGGCTTGTTTGCAAAGGCCCTGGCCAACGTCAACATTGGGAGCCTCATCTGCAATGT
AGGGGCCGGTGGACCTGCTCCAGCAGCTGGTGCTGCACCAGCAGGAGGTCCTGCCCCCTC
CACTGCTGCTGCTCCAGCTGAGGAGAAGAAAGTGGAAGCAAAGAAAGAAGAATCCGAGGA
GTCTGATGATGACATGGGCTTTGGTCTTTTTGACTAAACCTCTTTTATAACATGTTCAAT
AAAA


invisible?    
Gene introns: 0  

>1757 167 2589     12q24.31    chr12:121031770-121031933 BLAT!
TTTTTTCACTGAAAACTTTTTATTGCTCTTTTGGATAGAAACGGGAATTTATTTGCCAGG
AAGGATGATCCCATCATACTTCTGCTGGAACCAGCGCATGGCCTCCTCTTTGCTGATTCT
GTGTTTGGCCCCAATGCAGCCTGTCCTGCGCTTCTTGTCTGCGATGC


invisible?    
Gene introns: 0  

>28870 242 2588     4q34.1    chr4:175153058-175152817 BLAT!
TAAGTTTTTGACAATATTATGAATATTGTGCTCAATGAGAGTAAGCTTATTCATAAGCTT
TAATATTTAAAATAACAACTTGTTTATTCAAATTAAAACCTGTTTTCCTGTGTCAAAAGT
GAACTTTTTCCTAAATATCATTATTAATAACACTATTGCCTACAGTTTCTTGTCAAGCAT
TCATAAGTGAATGTGTCTTCTTCTAGAAAGTCATCTTAAGGAAATAATTCCAAATTGGGA
AA


invisible?    
Gene introns: 0  

>31315 318 2587     8q21.11    chr8:74826780-74827044 BLAT!
TGCTCAGAAGCAAGATGCAACAGCTGATTGTATGTTTCAACTGAAGGCTGATAAACGAAG
ACTCCGGAATTGAAGCAGTCAGGCCACCCTGGGTCTGGTGCTGCTGACAATTCTTCTCTG
TCAAAAAGATCATCAATATTTGCTAGGACCAGAGTATCTGCATCCATGAATACACATTTT
GAATACTGTGTAAGCGACCAGCAGTGGAGCTTTGTCAGCGTGACACCCAACTCTGGCCTC
TTCATTAAGGTTAGATGAGCAGAATCGCCACTGTCCAAGACATCTACCATGATGACTTCA
TCAAAGACTGTCTCTAAA


invisible?    
Gene introns: 0  

>25838 115 2586     9q33.1    chr9:120845565-120845482 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGGAGGGGAAGATGGTCAGTAGGACAGAAGGTA
ACATTGATGACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGA


invisible?    
Gene introns: 0  

>29471 262 2584     20q13.32    chr20:57208365-57208626 BLAT!
GGCAGCCAGAGAACAGAGTCCTTGAGGTGGGGAAGGGCTTGGCCAGTTCTAGGCATGCGC
CCAAGGCCACTTTGGCTGGAAAACGGTAAGGTCTGGAAGGCTCCGGTAAGGAGTAGGAAT
TTGGCACTGTCTCACCTAGGAGAGGGGAAACTGCTAACGCAATGGCACATCACCACCTCC
AGGAAGTCTTTCAGGGTTGCCTTTGTGGAGGTGAGCCGCCATACCACAGAAAGCCTGGGC
CTACTGTCATGGTCTCAACTGG


invisible?    
Gene introns: 0  

>2377 208 2583     11q12.1    chr11:56823182-56823389 BLAT!
TAATTTAATTTACATAGTGAAACAAGCCATTCTTAGGTATATTCCTTAGTTCTGTCTTCG
AAAGTCTGCATCCTGTTAGCAGCTGGCGTAGTTGGTGGGATACTTAGCAGAAGGATTGTA
TGTGTGTCCTACTGTTTCACTGTCCTCCTCCAGGTCCAATGCCATCAATCACTTTTTCTG
TAATAAATCCCTAGGGCTTGGTCTTTCA


invisible?    
Gene introns: 0  

>20787 330 2575     1q31.3    chr1:195098401-195098072 BLAT!
TTGCTCCTGCCCTAGAGATCTGTGGAACTTTGAAATTCAGAGAGGTGCTGTATGGTATCA
GGCAGAAGAAGTTTCAAAGCAGCAAAGTGTTCAAGATATAACCTGGGTGCTCTTAAAAGC
ATTCCGTTTTATATATTCACAGAGAAGGTTTGAAATTGGAACTTATGTTTAAAAGGGAAA
CAGAGCATAAAAATTTGGAAAATTTGCCGCCTAGGGATGCAAAAGAGAAGCAAAACCCAT
TTTCTAGAGAGAAATTGAAGTCAGCCCCAGAAATTAGCATAAGTAACAATGAGCCAATTG
TAAATCACAAGACAATGGAGAAAATGTTCC


invisible?    
Gene introns: 0  

>3298 433 2568     6q26    chr6:161211587-161211155 BLAT!
GTGCTGGGTGCAAATTGCAAGAATTATGCCCATTCACCTCCTCTGCTCTCCTCCAGGTGC
CTGTCCCCACCATCTTTTTCACATAGAGCTGGGCTGGGGAGAGATACTTAACCCTTGGTG
TGCCTGCCTGGCTGTTTGGCTCTGTGCTTGCTGTTTTTGCTTTCTTTCTCTCTGACTTCC
TCTCCTAGTTTCTTTTTCTTCTCTGCTGGTCTTTCCTTTGTCTCTGCCAGCCACCTATGC
TGCTGTTTTCCCCTTTCCTTCCCCTTCCCCTTCCCCTAGGGGAAGGACTGGTGGGAGTGG
AGCTACTCTTTCTTAACCCAAGAAGAAAGGAAAGGGGGCTTCTGAATATTTTTCTTACTA
CAGGAGTTTTGTGTGAGGTTCGACGCCCCCTCGTGGGGATTTCTCACCTCTTTCTGAGGT
TCAACTCCCCCTC


invisible?    
Gene introns: 0  

>22921 383 2560     6q12    chr6:66546819-66547201 BLAT!
TGAATTAAATCTTTACAACAGTTCGAATGCTCTTTCCAGAATGCATCAGTTCAAAGGCTT
TGTTGATTTCATCAAAAGACAGATTGTGAGTCACAAATTCATCAACTTTTATCTTTTTGG
ACATATATTCAGACACCAACTTTGGGACACTTTCTACACTCTTCCATCCTCCAAAGGCAG
TGCCTTTCCATGTGCGACCTGTTACCAGCTGGAATGGACGAGTGGCAATTTCTTCACCTG
AAGCAGCTACTCCAACCACGACGCTGACGCCCCAGCCCTTGTGACATGCCTCAAGTGCTG
CTCTCATGACCTTCACATTACCAATACATTCAAAGGAATAGTCCACTCCTCCATCGGTCA
TCTCAATGAGCACTTCCTGGATG


invisible?    
Gene introns: 0  

>8149 276 2555     12q24.21    chr12:116148250-116147975 BLAT!
TTACTCCAGAATCTACTTGCTTAACTGGGAATTGGAATGGTGGTGAGTCATTGGTCACAT
GGGGGTGGTGCTGGTTGGGGATCTGAGCAGAAGCTCATACAGATGCAGCTACCGCCTCAG
CAGTGTATCTTTCCCTTGCCAGTATTTGCAGCTGATTCACCAGGATTTTCATGCTTCCCA
AGGTTGCCTTGACTATGTATATGAGAGGAGTATCCGGGGCCAAGCCCAGCTGCTTTGGCA
AGGATGTTTATAGAAGAAACATCTCCTCCACACCCA


invisible?    
Gene introns: 0  

>13773 235 2553     4q13.1    chr4:61264707-61264473 BLAT!
CTGAAACTCCCTCATGTAGCTGTCTCAGGCCCCTGGTTTCAGAACAGTCTGGTGACCAGA
CTGACTTTGCTGGCCAACATTATGTTCCTTTCCCACTATAGCATGAGACTGAATAACTAG
ACCGGTGTTGAAATGCTGGTCTTGGGCTACTGTTACTCATATGGAAGAAAAGTTACATTC
AGGGCCAAATTTTGTGCTTCAGCTCTGTTTGGGTCCATTTGTCAGCTGTTACCTG


invisible?    
Gene introns: 0  

>22303 322 2513     Xq23    chrX:115607831-115608152 BLAT!
AATAGACAACACAGCTGGGAAGGTGCTGAGTCTCAAATTAAGCCAAGAAGTCAGAGTCTC
ATCCAAATTTCTGGATATACTTCCTGGGGATAGCTGCTGGTTATTCAGGATGCAATGGCT
GTATGGTTTGTAGGTGATGAATGCTGTCAGGACAGGGTTCTTCTCTTCAAGGCAGCAGGT
TCCCTTTTGGCCTATGGTGTGTTTAGAAATTTCATTCAGGAGCTAGGGCCTGGAAAAGGG
GCCTCATGAAGCTGACAGGTGCCCTATCTTGCTGTGGCTCAGCTCTTATACAAGATGCAA
GGAAAGTCCTCCCCAGTCTTTT


invisible?    
Gene introns: 0  

>17322 232 2512     11q14.1    chr11:79698913-79699144 BLAT!
CTAACAGAGGCCCTTCAGAATAATGTCACACCATATGTAGTCTCATTGCAAGCTAAAGAT
TGTCCAGATATGAAACATTTTTTGCAAAAGTTGATCTCACAGTTGATGGACTGCTGTGTA
GATATAAAATCCAAAGAGGAGGAAAGTGTTCACGTCACCCAAAGAAAGACACATTATTCA
ATGGATTCACTTTCCAGTTGGTATATGACTGTCACACAGAAGACGGACCCAA


invisible?    
Gene introns: 0  

>30835 367 2512     10q22.1    chr10:71564051-71564417 BLAT!
CCATGCTTTCCCCTTCCCAGACCTTCCTGCTGGCCTGACCATGCCCTGGCCTTTTCTAGC
TTCTTGCTTCCACTGCTTCAGACTTAGACATGCCAAGTCGCATACTCTAGGGGCCTTGGG
GCTAACTATTGTATCCGACATGCTCACTCCTTCCCTCCAAGCTGCAGCTCCATATTTACC
CTACTGAATACAATCTTTTCAACTGCTAGATATGAAAGTTATCCCAGAGAGCATCTGAAC
TGAACCCCATTTTTCAGATGGGGAAGTTGAGCCCAGAGTCACATGGCGAGGCCCAGGACT
AGAACCTCAGCCTCCTGGCCCTGTATACAATGTTCTTTGCGCTGTATCCTGCCACCTTTT
TTTTTTT


invisible?    
Gene introns: COL13A1 (71561643 - 71718904)  

>23599 235 2505     11q14.3    chr11:92380706-92380940 BLAT!
ATATTCTGAACTCTTCTTCATCTAGGAAACAGATGATAATTCTTATAACATTTTTCAGCC
CAATAGCATTGAGGGCTCAACATGAACAGCAGCTTCTACCAGGGGCTCTGGGAGATGTCA
AGTCCAGTAAGATACATTTCCTACTTCCAATGAGCTTATAGTTTTGCAACCAATAAACTA
TCAATTAAATGGAATTTCCTCAATCATGTTTCTGGATCTTAATACCTCTGGCCCT


invisible?    
Gene introns: FAT3 (92085261 - 92629635)  

>1103 226 2493     8q24.13    chr8:127044134-127044359 BLAT!
CAAGAATTTGGAACACCAAAGAAACAGAAATGTAAGTAACCAATTAGAAAACATGTGGAA
GTGTTATAACAGCATGAACAAGCTCACCATAGAATCACAGAGCTAGGAGTGATTGATTCT
GCCTTGAGGGAGAGGTAGGCATAGAAACAGCTTAGCAGGGAACGTGAAATTTGATTTGGA
CCAAGAAGGCTGAGTGGATAAAGAGGAGAAAGGCACTGTCGGCTGG


invisible?    
Gene introns: 0  

Shown 241-270 from 3142 sequences on 9 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs