Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2491-2520 from 3142 sequences on 84 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>3201 135 251     1p31.1    chr1:73012744-73012878 BLAT!
CAACATTTAAAATCTGTTTCATAATCCAGTCAAACATCATCAGCCTAAACTACAGGAAAC
AAACAATGCATAAATCTTATTCTGAGACCTTAGAAACAAAATACTTCTTAAATGGTAATA
CAGTTTTCTAAAAAC


invisible?    
Gene introns: 0  

>6758 109 251     8p12    chr8:35830722-35830614 BLAT!
CTGCTGGTGGTCACAGGACATACTTTGAGGAGCAAAGGCCTTGAGTGCTTTAAAGAAAAT
GTTTGTGCCAGACCCCACTAAACTATTTAGTCTTTAAAGATGGGCACCA


invisible?    
Gene introns: 0  

>16442 127 251     10q11.23    chr10:52415726-52415852 BLAT!
TAGCAAAACACACAATTTATTATAATGTATTTGGAACGTGTTTCAAAATTTACCATAGCT
ATCTATAGATATCTCTGTCTATCTAGGTAGATAGATGATAGATAGATAGATAGATAGGTA
GGTAGAT


invisible?    
Gene introns: 0  

>21891 142 251     8q23.1    chr8:109820565-109820424 BLAT!
CTGTGAATCCCCCTCATCTGCCTGAAGACAGATCTTCTAAAAAGAACTTGATTGTCATCA
ATCCTCTCCCTGGGGAGTTTCATCAGCCAGGGAAGATTAACTCTTATCACAGGAGAGGTC
AGATACCACACCCAGACAGACT


invisible?    
Gene introns: 0  

>27073 120 251     14q21.1    chr14:42664802-42664921 BLAT!
ATGTGAGAAAGCCCATATGCATTAGAAAACCTTTTATGACTTTTCATTCCTATCACTGCA
CCACTTCATAAAGCTCACCTACAAAGTTATCATCATACAGATTTTACTACCAAAACCATG


invisible?    
Gene introns: 0  

>32295 108 251     6q26    chr6:161218499-161218606 BLAT!
AAATAAAAATCTTTAAAATGTAAACATTTGGTCTAAATTATGTGGGTCAGATATTAGGTT
TTCTAAGTGATTTAAGGTCATAAACTGCTTCTTTGACTTTTGAAAATT


invisible?    
Gene introns: 0  

>4979 122 250     13q13.1    chr13:32757330-32757451 BLAT!
TTTTCATTATTTAGTATAAAATGGTTCTATAGATTTTATGTCCTAAACATACAAATGCAA
AACAACTTAAAATACTCATGTTTGTCAACTATTACATTCTTTTGCAGGAGGTCTGAGTTA
AA


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>8794 141 250     8q23.2    chr8:110512039-110512179 BLAT!
AGCAAGGATGTGATATGAGCTGAAGGGCAGCTATACTTGATGCCACTGGGAAACTCTAGA
GTGTAAGTTAAAATTGCCACGGAGTTGATCCCACATCTGGTGAGGTGGGTAGGGGACGGA
AGTCATTTGTATCCCCATGTT


invisible?    
Gene introns: PKHD1L1 (110374705 - 110543500)  

>10987 105 250     3p12.1    chr3:85409934-85410038 BLAT!
TTGTTACAAACTGGTGTTCTTAATTCTGAACTTGTTTCCTCAGTATCGTTGTGTATCTAT
TGTAGGTCTCACTGAGCCACTCCCTGGTTCAAAGTCATTCTGCAG


invisible?    
Gene introns: CADM2 (85008132 - 86123579)  

>12612 102 250     11p13    chr11:32251145-32251044 BLAT!
CAATATAATTCTGTATATGAAAGATTGTGTCATATAGAGATTGTGTAAACCCTAGCTCTA
CCCTGCCTTAGCTGGGAAGTTTTGATCAAATTGTTTAACCTT


invisible?    
Gene introns: 0  

>15019 117 250     8q21.13    chr8:84574567-84574683 BLAT!
AAAAAATACAATTTCAGGAAAGTGGCATAAGAATGAGATCAAAAAGAAAGTTGGGCTGCA
AAAAGTTCTTTTGCACACCTCTACTCTTCTTTCTGAATCGTTTCCATTATTTGAGTT


invisible?    
Gene introns: 0  

>27811 111 250     10p12.33    chr10:18037623-18037513 BLAT!
ATTACAGGTGTGAGCCACTGCTTCCGGTCACCTTTACAAGATTACCCCATGAGTGTTAGC
ACTCATGTGACGTGACCTGTGACCAGTGTTTTCTACCTCCTGGAATGCCCT


invisible?    
Gene introns: 0  

>10221 101 249     4q22.1    chr4:92672403-92672503 BLAT!
TGTGAAAAAATATAATGGAAGCCCTAGCCATGTGCAACTGGAAGGATCTAAAGGTGAACT
GTGCTGAGACAATACCTGTTACAAGCAGAGGGATTATCACA


invisible?    
Gene introns: 0  

>11151 131 249     6q14.1    chr6:77944964-77944834 BLAT!
CAGGAAGCACCCAGCACAAGAGAAACATGTAGGCTGGAAAGCTAGACCAGTCTAGTTTTT
TCCTGTTTTTCTGCCTTCTTTATATTCTAGCCATTCTGATAGCTGATTAGATTGTATCCA
CCCAGATTAAG


invisible?    
Gene introns: 0  

>11281 104 249     5q14.3    chr5:85975666-85975564 BLAT!
AAAACAACATCTTTTCTCATGTGGAAATAATGCCTGGGAAAGAACTAGAATGTCCATGTG
ACCAATGAGGTCATATCAGCCTTGAGTGGGTTTGGCTGCCTTGC


invisible?    
Gene introns: 0  

>12108 145 249     16q24.3    chr16:90277774-90277918 BLAT!
TTGTTGTTATTGATATTGTTGTTTCTGATGGATAGAGATCTAGGCCTGACACTCCAAGCA
GTGTGAACAGCATTTACCTTGATAAGCATTCTTACATCTTAACTCTCGGGAATTTTAAAT
AGAAGTGTTCCGTGTGATTAAATTA


invisible?    
Gene introns: 0  

>14427 102 249     4q22.1    chr4:92516651-92516752 BLAT!
GTTACATTATATTGTTACTGTGATGATGATGATTATTGTTGTGATTAAGGTAACTACATT
CCAGGTAATTAGGCATTTTATAATCAAGGAGGTCATTAAATA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>14529 101 249     9q31.3    chr9:113391236-113391136 BLAT!
ACTCACCAAATTATTATTTCCATTTTAGACATGGAGGACATGGAGTCAGGTCACTTGTCC
AAGGTCAGTTTAATAAATAACAGAAAAATAAATGGTGATAC


invisible?    
Gene introns: 0  

>15920 115 249     Xq21.33    chrX:95228961-95228847 BLAT!
AAGGTTCAATCTCTGTGTTTGAAGTGGATGGCAAGAAAAACAAGATCTACTGCCAAAACC
TGTGCCTGTTGGCCAAACTTTTTCTGGACCACAAGACATTATATTATGATGTGGA


invisible?    
Gene introns: 0  

>23831 134 249     11p14.3    chr11:22956023-22956156 BLAT!
AGGTATTTTGTTATAGCAGCACAAATGGACTAAGATAGCAACCAAAGGGCAATAAATCTA
GAAATCCCTAAGGTGGAATCCAGGGCCAATTTTCAGAGCCAGGTTGAGGGTGAGATGCCT
AGGGCACAACATTT


invisible?    
Gene introns: 0  

>29168 160 249     Xq22.3    chrX:104174375-104174534 BLAT!
CATCTTCATTAATGCCCAGCACAAATTTCTCAGATTCCAGATCTGCTTGGCATCTCCATA
TTCCTTCTGCATCCACCTCTTTGCCACAAAAGACACTTCATGTAAATGTCACTTTTTTCA
AGTTTTTCACATGTTCCACAGTGGAACCATATGCTTATAG


invisible?    
Gene introns: IL1RAPL2 (103810995 - 105011822)  

>32479 108 249     3q11.2    chr3:94462297-94462190 BLAT!
TTTTTTGTATTTTTAGTGGAGACGGGGTTTCACCATGTTAGCCAGGATGGTCTCAGTCTC
CTGATCTCATGATCTGCCTGCCTCGGCCTCCCAAAGTGCTGGGATTAC


invisible?    
Gene introns: 0  

>6072 106 248     Xp11.23    chrX:47362411-47362516 BLAT!
AATTGGCTGCTGAGCCTCTGATCACCCCTGACAGCACTGACTATGACACAGCAGGGGTGG
CACCTGCTCCTGTGATTTGCCGGCAGAACACCTGCAGATGCCATCC


invisible?    
Gene introns: 0  

>8343 132 248     15q14    chr15:33989382-33989513 BLAT!
GGAGCATCACCAAGGTGCAGGAAAGGGACCTTCAGGATCCTTGGAGGGAAATGCACTCAT
TCGTCAAACTCATTTCCAAAGAGAAATCTTACATAAATGAAGAGACTTTTATGGGAAGAC
AATACAGTTAGA


invisible?    
Gene introns: RYR3 (33603176 - 34158303)  

>13219 118 248     1p21.3    chr1:96274529-96274646 BLAT!
TGTGGATGTGGGTGGGGTGGCAGCAGAAGCAGGAATCAAGAAATGCTTCCTGGAAGAGAT
AATGTAAAATCAGAGCTGTAAAAGATGTATGTAAAATTTCTTGGGCAGAAAAGAAGGG


invisible?    
Gene introns: 0  

>21038 127 248     20q13.2    chr20:50650092-50649966 BLAT!
CAACTAGGTATGGTCATGTGACTGTTCTGAAAAATGAGATGTAAATGCATGTGTCACAGG
CGACTTCCCAATAACAGCCTTAGGGAAGGAGTGGGGTCTATCTGCCGCCCCTCCTCTTTA
CTGCTAG


invisible?    
Gene introns: 0  

>12253 115 247     10q21.1    chr10:57543742-57543856 BLAT!
TTCCTCTTTTTCACCTCGTCTTTAACCCTTGACAACCACTAATCTTTCCTCCATTCTCAT
AATTTTGTCACTTCAGTAATGTTATATAAGGGAAATTCCACATCACATAATCTTT


invisible?    
Gene introns: 0  

>18964 137 247     1q32.1    chr1:198729217-198729353 BLAT!
GTATGATGGTAGCTGTGGGTTTATCATATGTGGCGCTCATTATTTTGAGGTATGTTTCTT
CAATACCTAGATTATCAAGAGATTTCAACATGAATGGATGTTAAATTTGATCAAAAATCT
TTTCTGCAGCTATTGAG


invisible?    
Gene introns: 0  

>27817 110 247     7p21.3    chr7:11883138-11883029 BLAT!
ACAGTGGAAGCTCATACTCAAAATACTTAAAGACAAAAAAGTTGTCAACCAAGAAATATT
TATCTAACAAGACAATCCTTCAAAAATGACGAGGAAATAAAGAAATTGCC


invisible?    
Gene introns: 0  

>28682 116 247     12q14.3    chr12:66719665-66719550 BLAT!
CCACATAAGTTGGGGGCGGGGGGATAAAAGGTTGCCTCACAAAGATGGAGAGAGGGGATA
CATTTGTCAAAACTCAACCAACTTTATAATGAAACTGTATGCACATTATACCCCAC


invisible?    
Gene introns: HELB (66696355 - 66731958)  

Shown 2491-2520 from 3142 sequences on 84 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs