Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1441-1470 from 3142 sequences on 49 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>8640 150 538     2q22.1    chr2:138785084-138784935 BLAT!
TCATGGAGAAAGAAGAGAAGATAGGAAGGAAATGACAATGAAGAGATAAGAGGACACCAT
CCTTCCTTCAAGCACAGCACATGACAATGCAATGGGCTAAGAGCTATCATTTGAAAGGGC
TATGGGGAAAATGGTATCCTCAAAACAGGG


invisible?    
Gene introns: 0  

>23991 154 538     1p36.21    chr1:14468714-14468867 BLAT!
TCTTCTACTGAGATGTCTAGCTGTGCCCGCTTGAAGTCTTTAAAACCTCCATTTTCAAAA
CCTCCTGGTGCATGCACAGTTAGAAGCGTTTAAAATTCCAATAAAATACACAGTCTAAAA
ATGTCTTAGCTTTTAGCTACCAGGTTGTTCCTAA


invisible?    
Gene introns: 0  

>8527 131 537     2q22.3    chr2:146287970-146288072 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGTAGGTGGGCATTTCATCATGAAATGATATATA
AATACCTACCTCAGGCAAGTTAGAACTGTAAATATCATGAAGAGAAATTTTGAATTATTT
TTGAAAACTCA


invisible?    
Gene introns: 0  

>16899 168 537     4q32.2    chr4:164000319-164000486 BLAT!
AAGGATATTAGGATGGGCCCTAATCTTACATGATCAGTGTCTTTATAAGAAGAGGAGATT
AGGAGACAGACACAGTCACAGGGAGAACTGTGTGAAGACAGCAGAAGACAGCCCTCTATA
AGTCAAGGGGAAAAGCCCTAGAAGATACTACTAGGGATATATGAAAAA


invisible?    
Gene introns: 0  

>19351 161 537     10q26.3    chr10:133279646-133279806 BLAT!
ACTGCAGTGTCTCCTAAGAGAAAAAGACACTGCTGTAGATGCCAAAACTGGTAAAGCTGA
GAGCTAGACAAGGCTGAGGGAGAAAAAGAATATCTTTGTCACTAATTTATGTAAGGAGAA
AAACTTTACAGTAGATAAATGGATGAAATCAGAGTGATTAA


invisible?    
Gene introns: 0  

>4003 126 536     10p15.1    chr10:4246310-4246435 BLAT!
TGAGGTCAGGAGTTCGAGACCAGCCTCACCAACATGGAGAAACCCTGACTCTGTTAAAAA
TACAAAATTAGCTGGGCATGGTGGTGCACACCTGTAATCACAGCTGCTCGGGAGGCTGAG
GCAGAA


invisible?    
Gene introns: 0  

>11690 169 536     6q14.1    chr6:77863802-77863908 BLAT!
GACTGAAGGAATATAATGAATACCAAATAATGGAGAGCAATAAAATAAAGTGCTGTCAGC
TTTGTACTACAGTTTATTTATTCACTCATCTGTAGATGGACACTTAAGTTGCTTCCAAAT
CTTGGCCATTTTGAACAATGCTACAACAAACATAGTAGTGCAGATATCT


invisible?    
Gene introns: 0  

>11976 174 536     16p12.2    chr16:22657252-22657425 BLAT!
TAGCTGGTCTCCCTGCCTCTCCATCCTTGATCCCTACAGGCTTCTTTCAACATAGTAGCC
AGAGGGATCCCGGTAAAAATACAAGTCTGTCTGTGTCTCTTCTGCACTCAAAACACTCCA
ATGGTTCTGCAACTACCCCAGAGTAAAAACCAAAGTCATTCCAATGACCTAGGA


invisible?    
Gene introns: 0  

>19915 203 536     5p15.2    chr5:10213274-10213477 BLAT!
AAGAATTCATCATAATCAATCTGATTATTTTCATGTTTGCTAGCAGTTTGCATGATTTGA
CCAATAGTCATATGGATAATTTGAAATATGTTTGTTCATATCAGTCTAACAATAATCCAT
TATGTTCTGTAGCAAAGTAATTCTTTATGCCTGAAAAAAAAAATCAGAATCATCTGTTTT
AATGCAAACTCACCTGACACAGG


invisible?    
Gene introns: 0  

>5390 152 534     8p12    chr8:34358586-34358435 BLAT!
GATTTCAGGTAATACAGAGGTAGAAGAGAATATGATTAATGACACAGAATCATTTCAGCA
CTTCAGAGTTTATTAATCAAGTGTGTGATACACTAGGGCTCTAACTGGAATGCCAAATTG
CAGGTGCCCATGTGCCATTTCTAAATGAATCT


invisible?    
Gene introns: 0  

>20300 177 534     1q42.3    chr1:236275683-236275507 BLAT!
AGGCACTGCCCTCACTGTTGCAGTTCCTTCATTCTGTTGAGGGCACTGCCAGCGCGGAAC
CACTCAATCTGCGTCTCGTTGAAGGTGTGGTTCAGGAGGATGGTCTCCTGGGTCCCGTTG
GGGTGCTTGATGATGCACTTCAGGGGCTTGCCAGGGGGGAAGTCCTTCAGGCCCTGA


invisible?    
Gene introns: 0  

>24326 149 533     13q21.31    chr13:62892529-62892381 BLAT!
CCTGTGATAGAGATATGTAGTATATAATATGCCATAAGATACAGATCAGAAACAGAAATG
GGTGAACTGACAAGTTTAACTGATTATACCAACTGAAAAGACAAAGAATATGTTTGTTGC
TGAAACATGCTGGACTGAAGAGCTATAGT


invisible?    
Gene introns: 0  

>16655 129 532     3p21.2    chr3:52250744-52250872 BLAT!
TCTTCACTCAGACAAGGGTCCCCAAGGAGACCATGCTGAGCATGCCGGCTAAGGCAGACC
GTCTTGCAGTCTCACCATTGCTTGGCCTCTGACATGATGCCCTTCAGAGCTCTGGTCACC
ACCCACAAT


invisible?    
Gene introns: 0  

>20309 216 532     1q41    chr1:219401267-219401052 BLAT!
TGGACTTCTGTGTGTATGAAGCAATATCTTTATTGCTTAAGTCAGTTTGAGTTAGTATTT
TCTATTACATGCTGTTGCAAAGCATCCAAGCTGATAGAATATCCTTTTAAAATAGACAAT
ATGGAATAAGTTATTATTTAAACATATACTGTTCTCCGTTAAGAAAACCATATCATGGAG
AAAGGGTGATATAATAACATTCCCTCTTTTCTTCTA


invisible?    
Gene introns: 0  

>11258 164 531     3q26.1    chr3:166460587-166460424 BLAT!
TGAGTCGACAAATATTTGAAGAAATACTGGCCAAAATTTTCACAAATCTAATTAAAATTA
TTGAATTCTAGAGCCAGTAAACCAAATGAGTCCTAAAATGTATAAATTACAAGAACACAC
TGTCTAGCAACTTCATATACTAATTGCCCAGAGTCCAGTTTTTT


invisible?    
Gene introns: 0  

>17759 121 530     2q14.3    chr2:127518949-127518829 BLAT!
GTCAGGCTGAGTTAAAGTGCCTCTGGTCTTTACTGTTTGATATCAGGAAGGATTTCAAAC
CCCACCTTTGATACTCAGGCTGTTGCAGGGGGCCTTGGGTTTGAGCAGGCTGGGATGAGG
G


invisible?    
Gene introns: 0  

>24251 205 530     21q21.1    chr21:21909733-21909937 BLAT!
TATGATGCTTTAGTTCAAATAGGTCTTCAGTAATTTGTGTTTTTTTCCAAAATTAATGTA
TGTTTATTAAATGGGAAACCTAAAACCCATGGCTGTAAATTGCTGTTTCTGACTTGAGCT
GACATTTAAATCCATACAGTATATGAGATACATGATCTATTTTCTCTGAAGCATCACTGT
GTTACAGGATCTTTGGAGTGTTGGT


invisible?    
Gene introns: 0  

>24821 188 530     7p11.2    chr7:57866628-57866441 BLAT!
ACACTGGTTGAGGTCTTCCCCTGAGGCTGTTAACCTGCAAGTGCTTCTGGGCTGTATTTG
TGCTCAGGCAAAATCCTACAATAATGGAGATGCCCTAGGGCAGAAAGTGTAGCTTGAGTT
TGCTGGCAGCACAAGGGAAGCCTGCGCTTCCATGGAACTTCCCACAGTGGCTGAGACTGA
ATGAAAGG


invisible?    
Gene introns: 0  

>31585 223 530     6q25.3    chr6:160010154-160010376 BLAT!
TTCATCCACCTCTCCCCATCTCTACCTTTGTCATCTTAATTCAAGCCACTGTCATCTCAT
CTCTCACCTGGACCATGCATGGCCTTATAAATAATCCCCTACATTCATTCTGTCTCCTTC
CAATCCATCCTGTCCCCTGGTTAAAACAACAGAACAGTTTCTCATTGCTCTTAAAATGCA
AGAACCCAAACACGGCCTATGAGAGCCTGCACAGCTCCTTCCA


invisible?    
Gene introns: 0  

>20545 186 528     2p22.2    chr2:37065763-37065578 BLAT!
CATCAGTAAATGTATAAAAACACTTTTCCCTTAATACTCATGGCAATAACTATTGTAACA
TTAAAAAATACATAGAAAAAAGAAAAAAATCCTGGTGGATGTAGTGATTTTTCAGTGTTA
TTTTAATTTCCATTTTCCTGACTACTATAAATGTAGACATCTTTTCAAATGTTTTGGTCA
TCTGGA


invisible?    
Gene introns: 0  

>26716 179 528     3p12.2    chr3:80575137-80575315 BLAT!
AAAATTTTGAAAAGAGGTTAGAGAAGGAGAATCATTAGAAATAAGGGACTTATAAAGCTC
CCAGGTATATTAGGAAATAACAGAAGGCAACATGCATGCCCAAGGCTAGGCACATGCTCA
TAAAAGACCTGAGAAGATCTTAAATGTTCACCTCTGTGAACCTTCAATCTCTAAGCAAG


invisible?    
Gene introns: 0  

>29557 215 528     11p14.1    chr11:27313675-27313461 BLAT!
ATTCTCCCTTGCAGTATCATCTATGCCTTAGACCATACATTTCCTCTTTCCTCTTCAAAA
CTTACCTGTTTCCACTGTCTTATTCTTTCAGCAACTGGCTTTATGCAATGGGAACTTGGT
TGCTAATGGGTTTTTCTCCCCTTAACAAATCCTTCATAATGTGTAAGATAGCTCTTGCTT
TATCTGTCTACCTCAGTGTCATAATCTCTTAATCT


invisible?    
Gene introns: 0  

>26896 154 527     12p11.1    chr12:33608209-33608362 BLAT!
GAATGCCTGGACTTAATGAAATTCTTAGTGATCCAGAGGTTCTTGCAGCCAAGCAGGATC
CAAAAGTTATAGTGGCCTTCCAGCATGTAGTCCAGAACCCAGCAAACATGTCAAAATACC
AGAGCAACCCAAAGGTTATGAATCTTATCAGTAA


invisible?    
Gene introns: 0  

>29077 169 527     3p26.1    chr3:5884880-5884712 BLAT!
AATATTTAGAAAAATATTTTGTATCTGTTGTCTCACCCCCAAAAATGGAGCTTAGAAAAT
ATTGTATGCATTATTTTAACAAGTAAATGTTGATTATCTAATCTGTGCAATGTATTTTGC
TAGATGCTGGATTGATTTTTCTTCAGAAAATGGAATAATGTAAGTGGTA


invisible?    
Gene introns: 0  

>31407 216 527     5q21.1    chr5:101187285-101187500 BLAT!
TAAACTGAAATTGTCAAAAGTCAAAGATAAAAAGAATTTTGAAAGCAGCAAGAGAAAAAT
ATTTGTCATGTATAAGGAAGCCTCCATAAGACTATCAGATTTCTCAGCAGATATCTTGCA
GGTCAGAAGGAAGTGGTATAATATATTCAAAATGCTAAAAGAAAAACAAAAAAACAAAAA
TACCACATAAGGGAAAACTGTCTCTCAAAATGAAAG


invisible?    
Gene introns: 0  

>11249 214 526     11p15.4    chr11:5219653-5219440 BLAT!
GTGTAAAATTATTCCTAGAACAATAAATTAGGTCTTCTGGGTTACAGTATAAGGTTAATT
TGAAGGATAAAGGAGTGAATTTCCTGATGTCAAAGAGGATCTAGTGCATCTTCTGGTATA
GCTATCAGAAGTGAAAACTGTGAGGTAGGTTCTAGAGGGGAAAATGTCAATATATATATT
TTTTACTATATAATCATAGTAGCTGCCGAGGCGG


invisible?    
Gene introns: 0  

>2612 195 525     21q21.2    chr21:24206139-24206333 BLAT!
CAATACAGCTAGATTAGATTAACACCAAAAAAGAGAGAGATCCAAATAAGCACAGTCAGA
CATGACAAAAGTGGCATTACAACAGAAATAAAAAAGATCCTAAGGGACTACTGTGAACAT
CTCTATGCACACAAGCTAGGAAATCTAGTGGAAATGGATGAAGTCCTGGAAACACACAAA
CTCATAATATTTAAT


invisible?    
Gene introns: 0  

>13085 202 524     Un_gl0002200    chrUn_gl000220:161255-161054 BLAT!
TGCCAGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCCGCCAAGCCCGT
TCCCTTGGCTGTGGTTTCGCTGGATAGTAGGTAGGGACAGTGGGAATCTCGTTCATCCAT
TCATGCGCGTCACTAATTAGATGACGAGGCATTTGGCTACCTTAAGAGAGTCATAGTTAC
TCCCGCCGTTTACCCGCGCTTC


invisible?    
Gene introns: 0  

>31948 170 523     6q23.1    chr6:131049061-131048892 BLAT!
GTGATGGATTACGTTTATTGATTTGTCCATGTTGAACCAGGCTTGCCTCCAAGGGATGCT
CCTGCAGACTGGAGCTGTTCCTATTCGGCCATCTTGCCAGATCTCCCCTGGATATCACCA
TTTCTAATCGCCATTGCATTGGAGGTCCTAGAATCATAGCGGAAGGCAAA


invisible?    
Gene introns: 0  

>4282 183 522     2q22.3    chr2:148329817-148329999 BLAT!
TTTCTCTAACAAACTCCCACAGACTTTTCACATCAGTTCTTGAATTATTTGCAAAGCCTT
CAATTGATGGAGGCCAAAGATGTCAAATCTTTGAATGACAAGGAGCCCAGAATACTTCTC
CTGTTTAGTAAAGGACATCAGATCAGGCTCCTAGACCATAAAATCAAATATCTACTTGAT
CAG


invisible?    
Gene introns: 0  

Shown 1441-1470 from 3142 sequences on 49 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs