Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1171-1200 from 3142 sequences on 40 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>17981 184 664     10q26.12    chr10:123046375-123046192 BLAT!
TGTGGAACAAGAATAAGAAAACTGTGGCATTTTGTTTCTCAAACTCTCTAGAGGATATTT
CTGGAGCCCTGAAAGTGACTTCAGACAATAATGAAATTTGATGGCCTCCTAGCTCGGTGA
GTCCAAACATGGAGGAACTACTCATAATGTCACAAAGTTGTCCAGATGCTCATGGCCTGT
GGTT


invisible?    
Gene introns: 0  

>7972 193 663     6q13    chr6:70270463-70270271 BLAT!
ACCAAAAAACAAAACAAAAAAACTCCTGCAGCTAACTCAGTGTCTGCCCAAAGGGCCACC
CAGTTTTTTGCTTGAAACACAGGGCCCTGGTGGTGTAGGCACCCGAGGGACTCTCCTGGT
CTGTGGGTTGCAAAGACCATGGGAAAAGTGTAATATCTGGGCCGGAGTGCACCATTCCTC
ATGGCACAGACCC


invisible?    
Gene introns: 0  

>3120 103 662     19p12    chr19:24344894-24344968 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGATGGATACAGGATTTATGGGGTCTAAAGAGA
ACATACAATTCTAAAGTGTTCATGTTTGAGAGAAAACTCTGCA


invisible?    
Gene introns: 0  

>9510 178 662     8p11.1    chr8:43518514-43518337 BLAT!
GCTCTCAAATGTCCCTTCACATATCCTACAAAAAGAGAGCTTAAAACCGAATGAATGAAA
AGAAAGGATTATCTTTGTGAGATGAATCCAAACATCATGAAGGAATTTCACTATTAGCTT
CTTTCTAGTTTATAGTTGGGGATATTCTGTTTTCCACCACAGGTCTCAATGGCCTAAA


invisible?    
Gene introns: 0  

>25344 227 662     20q13.12    chr20:45432576-45432350 BLAT!
TTGCAGTGGCGACAAAACAGCTTAATTCTGGCAGAGGAGACAAGCAACAGCCAAGTAAAG
GACCAAATGCCCAAGAAGCCATCGCCCAGGTGGCTGCTGTGCTGAGCTGCAGAGCAGACT
GACGGTTGCATCGAGAGGGGCTTGCCAAGGAGGTCCCTATGAGGGGGTAACACTTGAGCT
GAGTCCTGAGGCATGAGAAGGAAACAATCCGGCAGTTCGGCAGAAGG


invisible?    
Gene introns: 0  

>20150 209 661     20p12.1    chr20:16141525-16141317 BLAT!
AATGTTGGATAACTTAATCATTAGACAACTAATTATTAGCAAACTAGCTTTAAGAATGAG
CTCAAGTCCCGAAAGATTCCCTGGGTATTGGTCATGATCACGGCCAATACTCTGTCGGAC
TTCAAGTGATGATCAAATATTGCAAGATGATGATAAAGTCTTTAGAGATTCTATTGTTAT
GTGGGGAAATATCCGAATACCAGGATAAT


invisible?    
Gene introns: 0  

>3146 168 660     1q24.2    chr1:168126308-168126141 BLAT!
GAATTAATATTGTTAAAATTACCCTACTACACAAAATTATCTATAGGTTTAATGCAATCC
CTACCAAAATCCCAATGGCATTATTTACAGAAATAGAAAACACAATCTTAAAATTCATAT
GGAACCACAAAAGCCTCTGAATAGCCAAAGCCATCCTAAGCAAAAAGA


invisible?    
Gene introns: 0  

>29353 178 660     2p16.1    chr2:60962262-60962423 BLAT!
TACATTTGGTATATCTTCATTCTTTGAAACACAATCTATCCTTGGCACTCCTTCAGGCTT
TAATCCAATTATTCTGTTCATTTTCACAAGAATACAAGGGTTTCCTTGAGAATAGCCAAA
ATCAGGATCATTCATACCACTGCATGCTTGAAGTAATGAAATAGGAAACTGACATGCA


invisible?    
Gene introns: 0  

>32905 187 659     15q14    chr15:39835300-39835486 BLAT!
CTGCTAACAAATCTCTGTCTCAAAGTGTTTCATGGGAAAACCAACCTAAGGCAGTGGATG
TCAGGAATGGTCAGAGGAAGCTGACTCTAAAATAGAACTTAGGAGATGGGCACCTCCTAG
CCCATTAACAATGAGGACCCCATCACTAGTGAAAACTGAAGTTTGTATGGCCCTCACATG
TTATACT


invisible?    
Gene introns: 0  

>6333 203 658     21q21.3    chr21:28145396-28145194 BLAT!
ACTTGTTTCATTTGTTTCACTTGTTTCACTCGTTTCACTATTTAGCACATGTGTAACGTT
TTTATTATTATTGAGTTTTAAGCATTTTCTATTTTATCCTATAATTTTTTTCTTGACACA
AGAGTTGGTTTTTAAACTTTAACCATACAAGCTAATTATTAATATTTTTCTTATCAATAT
CTAACTTAACAGCATTATAGTTA


invisible?    
Gene introns: 0  

>10047 161 658     2p25.2    chr2:5739107-5738947 BLAT!
TGTTTTGAATTCCAGTCTATGTTTGATCATATAAAACTGCTGGCATTCCGCCTTGTTTCA
CCAACAAAAGCAGCAATTCATATGGTCCCCTCTAAGCCCTACATGAGGGTCCCTGAAGGG
GCTCCCTGCAGTTCCATCCTCCATCTTTCAAGGATTCTTTA


invisible?    
Gene introns: 0  

>18224 207 657     7p22.2    chr7:4412611-4412817 BLAT!
TCCCTGCTTTCTTGCACCACGCTGGGATAGCTGCAGTGTAGAAAGGAGGCCTGGAACATC
TCATGATCATCTTGGCTGACCTGAGAATCAAGCTCTGGCACACTTTGCCTGTGAGTTAAC
TCAACAGATGTTCCTGAGCCACTCCACCTCTGCCTCCACTCCAGATGCTGAAAAATCCTC
CATTTCCCCAACTCCCTTGCAGCTAGG


invisible?    
Gene introns: 0  

>23244 176 657     2p12    chr2:76156441-76156615 BLAT!
TATTGGCTCTTCTGAGAGCAAAAGCATCCAGAGAACCCAAACAGGAGCTGCTAGACTTTT
AATGACCTTGTCTTGGAAGTCTCAAAACATCACTTTTGCAGCATTCTATTGGTCAACCAA
GTAACCCAGGCCAGCCAGAGTTAAGGGGAAAGGGGAGAATTTGCGTAGTGGCGGGG


invisible?    
Gene introns: 0  

>27233 188 657     4p15.33    chr4:11306080-11305893 BLAT!
GTGGAATAGACTTGGGGAACACTGAAGTAATCATATGCTAATTCTCTCACTCCGTTGGTG
GATATACATACTAATCAATATGTTATACTTCACCAATTTAGAGTAATGGCATTTCCTGAA
CTGTGTTTAAGAGTCTTTGAGGGACTTTAAATTCTTCTTCCTCTGTTTCTTGCTTCCAGC
AATTTTGA


invisible?    
Gene introns: 0  

>32697 181 657     Xq13.3    chrX:74959985-74960167 BLAT!
GGTTTTTCAAACACAAAAGGGGAACAAACATGGGGCGCTTGAATATGTTAAAAATTCTTT
TTTTTTGAGACAGAGTTTCGCTCTTGTTGCCCAGGCTGGCGTGCAATGGCGCAATCTCGG
CTCACCACAACCTGCGCCTCCGAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAG
C


invisible?    
Gene introns: 0  

>7422 188 656     Xq28    chrX:155225870-155225683 BLAT!
AAAAGAAAAACAATAATAATCATAATTTCTGCAATGAACATTTGGATTGTTGCCTGTATA
TGCTATTTTATTTATTTTTATTTTCATTTCTTTAGACACAGAGTCTTGCTCTGTCGCCCA
GGCTGGGCTGGAGTGCAGTGACATGATCATAGCTCGCTGCAGCCTCAGACTCCTGGGTTC
AAGCATAT


invisible?    
Gene introns: 0  

>14383 165 656     7p12.3    chr7:48195061-48194897 BLAT!
AATCCTGGAATTGTGACATATGGAAAAGGCTCCAAGGGAGAGAAAAAATAAAAACACACA
CTCTTACACTCACCAGAGAACCTACAAAAGAGTCCCTGCAGTATGGAGCTCTGTCGCGTC
TCCCAACCCTAGTTCCGGTGAACACCCATAACAAATCTGGACTCC


invisible?    
Gene introns: 0  

>3581 139 655     4q34.3    chr4:182444042-182444155 BLAT!
TAGCAGTTGTTGCTGGAATTGTTGTGCTGGTTATTTCCAGAAAGAAGAGAATGGCAAAGT
ATGAGAAGGCTGAGATAAAGGAGATGGGTGAGATGCATAGGGAACTCAATGCATAACTAT
ATAATTTGAAGATTATAGA


invisible?    
Gene introns: 0  

>24556 206 655     1p36.21    chr1:14223253-14223048 BLAT!
TTAGCCCCAGTTGTCACCAGGGACTATGCAATTTAGAGGTTAAAGGCAAAGGCCTGAGCA
TCAGACCAAGGCTTTCCTTCCCAAATGGTGTGAAGGTGGGCATGCGGGCAACCCCTGTGT
ATTTCCTTTGCCTATGGAAATTGGGTAGGATTTTTAAAAATTACAGGAGCCTGGCATGGT
TGCTCACTCCTATAATCCCAGTATCT


invisible?    
Gene introns: 0  

>25226 171 655     1p21.3    chr1:96884446-96884277 BLAT!
TCTTTGGATTCTTGTTACATGTTCGCACATAAAAAGAATTATCCGGTGGTCGTCTCTTTT
CCTTGCAGCTGGAAAGCATGCTAATAATGCTAAGACAAACTGATTGGACTGAGAGCGCTG
GGGACCAGTCTTCTGTTAGAATGGATAAACAGATATGACCATTGCTATAAA


invisible?    
Gene introns: 0  

>28574 190 655     20p11.21    chr20:22762709-22762520 BLAT!
TTTTATCCTTTGACAATATATTTTAGCTCCTGTCAAGAGGCCCTATTCATATGTCCCTCC
TTGTCCCTGGGTTTAGAAACTGCTCCTTCCTGTTTTTCACTCAGGCCTGGGGTGAGAGAG
GTGTAGAGAAAGTCACTCTGCTGTCAGTAGCTGACACTTTGCAAATATTCCCTTATTAAA
CTGTCTTCAA


invisible?    
Gene introns: 0  

>12584 201 654     18q12.3    chr18:37543705-37543905 BLAT!
CAAATACTCTGATTTGTAGTCTGGAATGCTGGTCATTATTTACGCTAATAACCAATATTC
ATATTCTTCCTTCTAAGACATGGTAGGATTGCACTTCTCTCCTCTTTAGAAGTTAGGCAG
GGATGTATTATTGCTCTGGCTAGTGAAATGTGATAGTAAATAATATCCGTCATGTGGAAG
TAGAAGCCTTTATGGACCAGT


invisible?    
Gene introns: 0  

>14658 207 654     1p31.1    chr1:79216134-79215934 BLAT!
TATTCTGGCTTCTAGGTCATCACCATACATGTCCTTGTCCAGATTTTTACTGGGCCTATA
AATACTCTGGGCCATATCTTTACCACCTCTCCAGGCTTGATCATAAACATTATAAATTTC
ATCTTCTCCACCTGCAAATCCACTGTCCATACCCTTGGATTGGTTGAAGAGCCTTTGGTC
ATACTGAACTTCATTGGAAGTCCGAGG


invisible?    
Gene introns: 0  

>6995 179 653     15q21.1    chr15:46368624-46368802 BLAT!
AATGCTAAATCTTAAATATTTCCCCTCAGCAAAGCAGACTTCATCATCTTTGAGGTCCTA
ATCCACCTGTGACTACTTCACCTTGAGATCATGAGAGCAGGCCAGTGTCATCTCAGTTGG
GAGGATGAGTAAGCTTTGAGGCATGGAAGGCCTTTCCCTCTGTGAGGACCTGGGCCGTT


invisible?    
Gene introns: 0  

>14956 163 653     6q16.1    chr6:98848501-98848663 BLAT!
TGCGGTAACTCCTCTAATCCCAACTTTTTGGGAGGCCGAGGTGGGTGGATCACCCAAGGT
CAAAAGTTTGAGACCAGACTGACCAACATGGTAAAACGCTATCTCTACTAAAAATACAAA
AATTAGCTGGCCTTGGCAGTGCACCCCTGTAGTCTCAGCTACT


invisible?    
Gene introns: 0  

>22113 231 653     4q25    chr4:108274787-108275017 BLAT!
GTCCTTGGAGTGTTTGATTTTAAACACTACCTCTCAAATTCCATATTATTGTCATTTATC
ATTCCAGTTCAATTTGTTAATGTCATGCTAGTTAGACATTATTTCATCATATTTTTGTCA
ACGTTTATTTGGATTACACTTTTTTTACATGACGTAGTTCTTTGCACTCTACTGCTTTAT
TGATTTCATTCTTGTAGGGACCAGCCCCACAGGTTCAGTGGGTTTTTCTCC


invisible?    
Gene introns: 0  

>25984 158 653     10q11.21    chr10:43051135-43051020 BLAT!
ATGAGGTTCTCCACCTGGGCTTCCTCATCTCCTGGGGCCCGGGGCTTCTGATTGAAACTG
CACTTGCACCTGCGACTTAGGATAAGGAGGATCCCAACCGAGAAGAGGACCACAGCGAAC
ACCAGTCCCCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>9075 144 652     2q37.2    chr2:236169753-236169896 BLAT!
TGAGTAAATTCACTCACCTGTGACATGCATAATTTACAACTGCAAGTTTAATAACTGTAG
TTCTCCGCATCAAGCACTTTAACAACAATTTCTAACAGCAAGCAATTTCTATGATATTCC
TACACAGCCTGGAGTTTACTAACC


invisible?    
Gene introns: 0  

>23192 162 652     3q13.31    chr3:115484942-115484781 BLAT!
ACAAGCTGTGAATGCTTTGATAAACATTTCCCTCTTGGAGAGTGTGTAGGCAGTCAGATG
AGTATTTTCATGACACGAATAAATATGTGAGTGCCGTGGCATTCGCCCCCACTCCACCAC
ACTACCTTCAACATTGTTATGAGAAAAGGGGAGGGGGGAACA


invisible?    
Gene introns: 0  

>627 175 651     17q22    chr17:54446281-54446455 BLAT!
TTCACATCCTACCCCTTTGCACTTGTGGCAACAGATAAGTTTGCAGTTGGCTAAGAGAAG
TTCCTGAAGGGTTTTGCTGCATTCTAATGCATGTATTCGGGTTAGGGGAATGGAAGGAAT
GCTCAGAAAGGAAATACATTTATTCTAGACTCTGGACCATACACCATCTCCAGCT


invisible?    
Gene introns: ANKFN1 (54230835 - 54560007)  

Shown 1171-1200 from 3142 sequences on 40 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs