Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2071-2100 from 3142 sequences on 70 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>14135 167 339     Xq27.3    chrX:142247267-142247433 BLAT!
CAGGCATGTCTGAATCCTCTTCTGCCAGGCAACCTTCCTCCCTTTGGGGAAGCACATGTG
CATGTGAGCACATGTGTGCACGCGTGCACGCACACACACGCACACACAATGGGGGGAGAG
AGAGAGAGAGAGGATAATAGTAAACGAACAAAATGACACTCCTTGAT


invisible?    
Gene introns: 0  

>19198 172 339     2q36.1    chr2:222469113-222468942 BLAT!
TGTAAGCAAGCCCTGAGTGACACTGGGGCTTGTGCCTCCTTAGCCCTAAGCATTTTGAGA
CAAACACATTTGTCCAGAGGAAGGAAGCCACCTCCCACTGGCAATATCCTTGTAATATTG
ATTGGAAAAATAAGCGTGGACTACGGATGAAGTGATTGCACCTCCTTCAGCT


invisible?    
Gene introns: 0  

>30543 143 339     4q13.2    chr4:68096264-68096122 BLAT!
TTCCTATTAAGAAACAGGGAGAGGAGGCTGGGTTCAGTGGCTCACGCCTGTAATCCCAGC
ACTCTGAGAGGCTGAGGGGGGCAGATTATGAGGTCAGGAGTTTCAGACCAGCCTGGCCAA
CATGGTGAAACCTCATCTCTACT


invisible?    
Gene introns: 0  

>374 116 338     20p12.3    chr20:6194660-6194747 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGAAAAACAAGGGACCAAAGTAGCAGATTCTAG
TAAAGGACCAGATGAGGCAAAAATTAAGGCACTCTTGGAAAGAACAGGCTACACAC


invisible?    
Gene introns: 0  

>3370 168 338     14q22.2    chr14:54514093-54513926 BLAT!
GAAAAGGAGGAGGGGGTCCAAAGAAGAAGAATTTGATTTCCGGGTGCCTATGAGAGGGGT
CGCCACATGGGTGATGCTCTTTAGGGCTTGTTTGGAAGACCCATAAATTTTTAAGATCTG
GAGAAAGGTGGAGCAGAATGAACATGCCTCTCAGCCATGAACTCATAA


invisible?    
Gene introns: 0  

>4457 120 338     5q22.3    chr5:113269484-113269365 BLAT!
TCAGGAGATCGAGACCATCCTGGCTAACATGGTGAAACCACGTCTCCACTAAAAATACAA
AAAATTAGCTGGGCGTGGTGACGGGCGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCA


invisible?    
Gene introns: 0  

>12765 183 338     4q26    chr4:115854906-115854724 BLAT!
TTCGTATACCTGTTGGGCATTTGTATGTCTTCCTTTGAGAAATATATTTTCAAATCTTCT
GCCCATTTTTAAGGGAGGTCATTCCTTTTCTTACTATTAAGTTGTTTGAGTTCCTGATAC
GTATTTTGGATATTAAGCATTTGTAGATATATGGTTTTAAATATTTTCTCTCATTCCATA
GGT


invisible?    
Gene introns: NDST4 (115748926 - 116035032)  

>17580 151 338     5p12    chr5:44476135-44476285 BLAT!
AAAATGAATACCAGGCCGGGTGCAGTGGCTCATGTCTGTAATCCCAGCACTTTAGGAGGC
CAATACAGGAAGATCAGCTGAGGTCAGGAGTTCGAGACCAGCCTGTCCAACATGGTGAAA
CCCCATCTCTACGAAAAATACAAAAAATTAG


invisible?    
Gene introns: 0  

>19725 122 338     2q21.2    chr2:134586164-134586043 BLAT!
CAGAGCAGGTTTGGGCTATTCTGTGGAGGAGATGTCAGAGGACCACCGTAGTTCTGAGCT
TGGCTGAGGACACCTAGCAAAGCCTCAGTCCTCTCCCAGGTCATGAGAAGCAGTGTTGCC
AT


invisible?    
Gene introns: 0  

>22265 138 338     15q21.2    chr15:51273274-51273137 BLAT!
GCTCCACTAGGCACTGCCCTGGTGGGAACTCTCTGTGATGCCTCTGATCCTGTATTTCTG
CTCAGCATTGCCCTAGTAGGGGCTTTCTGTGATGGCTCCACACCCGTGAAAAGTCTCTGC
CTAAGCCCCAGGGAGTCC


invisible?    
Gene introns: AP4E1 (51200945 - 51298097)  

>30850 135 338     6p12.3    chr6:51559936-51559802 BLAT!
AAAGAAATATTATTAAATACTTTTAAGTCCATTTTTATTCAGCTTTGTCTACTTGCCATT
GGTTATAATAGACTTAAAACCTTAAATCTTATTCCTTTATTCTTCAATTTTTGTTTTAAA
ATTTTGGCAACATTG


invisible?    
Gene introns: PKHD1 (51480144 - 51952423)  

>7267 133 337     2p16.1    chr2:57388140-57388272 BLAT!
TGAACATCATGTTTACATTATTTCTTCTTGTTCCACTGGTTCAATGGGGCTAATGCAGAG
GGCCCAGATGGTTGCTGCACATGCAGTGGGTTGCATTACAGGAGAATAGTGAGCATCGAT
AATTGACTAACCT


invisible?    
Gene introns: 0  

>8437 146 337     10p13    chr10:16168523-16168668 BLAT!
TTTATTTATCTTGGTGTCAAAATTGCTACAACTGAAGGATACTAAGTTTCCACAAACTCT
AAGGCAAAACTTCAAAGAGTTACAAATACTATTAACAGGGAATTTGGACCTAAAGTAGGA
GAGAACAGTAGTTCTCTTAGGGAGTG


invisible?    
Gene introns: 0  

>27648 120 337     7p12.3    chr7:48195211-48195330 BLAT!
TAACTTTTTTCTATACTATTTTAAGACATATTAGTTGCAGTAAGTGGGAGATAGGGTGGG
ATGGTCTTAATCCATCCTAACTGGAAACAGAACCTTAAATCTTGGCTTTGAAGTAAAAAG


invisible?    
Gene introns: 0  

>28969 156 337     16p12.1    chr16:25553666-25553511 BLAT!
GAGACCTAGCCAGGTTGTCATTGAGCAGGCTTTGCGGTGGCCAGAGAAGCCATACTGCCA
GTGAGTATTGATCCTCCATTGTTCCTCCCTCCAAGCAATTCCAAAGGCTCATCCATTCCC
CTTGGGTCTGAGCTGCTCACAACAAAACAAAAGTAT


invisible?    
Gene introns: 0  

>25391 137 336     7p14.1    chr7:40927211-40927347 BLAT!
GGAAGACACAAGAGTTCTGATTTTGAGAAGTTCAAATAGGTCCTTAGGTAGGCATATGTT
TATCCAAGACCTTTCAATGCCCTGGGAGTTGTCTGGACTAGAGAGACAAAGGTGGGAGGG
CTGAGCTTCCTGAAAGA


invisible?    
Gene introns: 0  

>27237 124 336     12q21.2    chr12:79091523-79091646 BLAT!
TATTTTTAGTAGAGATGGGGTTTCACCATGTTGTCCAGGTTGGACTTGAACACTCAACCT
CAAGTGATCCACCCACCTCGGCCTCCCAAAGAGCTGGGCTTACAGGCATGAGCCACCATG
CCTG


invisible?    
Gene introns: 0  

>28411 132 336     4q31.3    chr4:151890512-151890643 BLAT!
AGGAACATTTTTGATTCATGGGAGGAGGAGTTTGGAAGAAATGGATTCCAGACCCCATGG
ATGACTTTGAGAGGTTCAAGACTTCCATGGAGGAAGTCACAGCACATGTGGTGGAAATAG
CAAGAGAACTAG


invisible?    
Gene introns: LRBA (151185595 - 151936649)  

>31670 135 336     3p26.1    chr3:7756980-7757114 BLAT!
CTACAAAAATAAAAAATAAATGAATAAAAATTTAGTCAGACATGGTGACATGTGCCTGTA
GTCCCAACTACTTAGGAGGCTGAGGCAAAAGGATCACTTGGACCCAGGAGTTCAAGGCTT
TAGTGAGCGACCATC


invisible?    
Gene introns: GRM7 (6902801 - 7783218)  

>6269 113 335     Un_gl0002170    chrUn_gl000217:6150-6262 BLAT!
AGCTACTCAGGAGGCTGAGGGAGGAGAACTATTTGAACCCTAGAAGCAGAGGGAGCCAGA
TTACACCACCACTGCACTCCAGCCTGGACGGAGAGTGAGATTCTGTCAAAAAA


invisible?    
Gene introns: 0  

>11294 172 335     4q28.2    chr4:130943418-130943247 BLAT!
TTGGGAGTGAATGTCACCTGAAGGCAGAAAAATGGAAAGCAGCAACATTTTACTTGATCA
CGCCCCAGCTGCAGACTTGTGAGCAAAATAAATTTGAGCATTGTTTTAAGCCACTAAAGT
TCTAAGGTGCTTTGTAATACAGCCATAGCAGCTGGAATACATGGGTTTTAAA


invisible?    
Gene introns: 0  

>13607 161 335     11q14.2    chr11:87185711-87185871 BLAT!
ATTCGGGAAGTCAGTCTCAGTAAAATCAGATTCTGAGAGTCAGAATAGCAGTGATTAAGA
GCATTCCAGTTGCAGCTCTACCACTTACTAGCTCTGTGATCTCAGACAAGTGACTTAGCT
TCTCTAATCTTAGTTTCCTCATGTGTAAAAGGGATGTAATA


invisible?    
Gene introns: 0  

>15454 140 335     6p25.2    chr6:3057960-3057821 BLAT!
GGCTATTCCTCAAAAAGCTAAACATAGGATGACGATAGAATTGTTATAACAATTCCATTC
CTCGGTAGATACCCACAGTATTAAGCGCAGGGAGTCACACAGATACATATATGCCAAGAA
TCATTGGTGCATTATTCACA


invisible?    
Gene introns: 0  

>23321 134 335     2p25.2    chr2:6210081-6209948 BLAT!
TTATTTACTTCATCATGTTATAAAACAATAAGCTATTCCTAAGCATGACCAAAGCTCCTG
CTATGTCTATGCACTCAAATATTACCAATCCATAGCAAGAAGGAGCTGAGAAATGTTAAC
TGGATTACTCCTTT


invisible?    
Gene introns: 0  

>25595 133 335     Xp11.3    chrX:46279188-46279314 BLAT!
CAGCTCGGATTCCATGAACTTCTCTGGATTGTCTGGAAACTTAATCCGCAATTCTTGGTT
TTTATATGATCTCTTTTCAAATGTGAGGATCATTTTCTTCACTGAGCTTTCATCCAATGG
CTCCTCCTCTTCC


invisible?    
Gene introns: 0  

>26613 190 335     18q12.3    chr18:43357800-43357989 BLAT!
TGAAAGTGGGCTTGATGGGAGGATTTTTCATACTTTTATTAGGCTATTAGTGGCCACTCT
TGAAATTACAACATATATCATTGATTTATTAAACATTAATGTTAACTCTTAATTTTCCGT
CCTCCCAGACAATGCAAGGACCTTAGAACACTTTAACTCTATTACCTCCCTCCTGACTTG
CTATCGTTAT


invisible?    
Gene introns: 0  

>31755 113 334     3p23    chr3:31494518-31494406 BLAT!
CTCTTGGGTGGTTTCTTTCTCTGTTATGAGCTGGAGAATATGATCTGGAACGAGACCTAG
AACTCAGCCTGCGCTTCCTTGAACGAGAGAGAGATCGGCTTCGGGACCGAGAC


invisible?    
Gene introns: 0  

>21142 155 333     5q23.1    chr5:120950378-120950532 BLAT!
TTATTTTAAATGAAATCATAACTGAATGGGGAAAGGTGCTGTAATTTTTTGTGAATATAA
CCGCATATTTACTTGACTCTTCTAAAACATCTAAATTCATCACGGCTTTTTTCTACCTAT
TCCACCCCTTGAAAACCTCCAAAGTATCTATATTC


invisible?    
Gene introns: 0  

>21425 148 333     1p31.1    chr1:83227091-83226944 BLAT!
TTGAGGTGATATATTTATTATAATATTTAGAGATGAATCGATGTAATTCTTTAACACTTT
ACTGTGGTTTAGTAGACTTAAATTCTTTGAACAATTCAATGAATTCCTTTACTTTCCTAA
ATACAAAATACATAACGTAGTAAGCACA


invisible?    
Gene introns: 0  

>21683 148 333     6q22.1    chr6:115940174-115940321 BLAT!
TTAGGTCACTAAACTATAATGAAAAATGACATTGGTAAAAATACTAGTCCCTAGGTCACA
CCTCAACATCTTCTCTTTAGAGGAACTTTCTTTGTTTGCTATAAATTTCTTTAGATGAAG
ATGATGTTGGATTTGTATTCAAAACAGT


invisible?    
Gene introns: 0  

Shown 2071-2100 from 3142 sequences on 70 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs