Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 2191-2220 from 3142 sequences on 74 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>25483 117 315     3q11.1    chr3:93514445-93514546 BLAT!
ACCAAAAGAAACGTTCAACACTCTGAGGTGAATGCACACATCACAAAGAAGTTTCTCAAA
ATTCTTCTGTGTAGTTTTTATATGAAGATATTTCCTTTTCCATATTAGGCTGCATAA


invisible?    
Gene introns: 0  

>29861 104 315     6q14.2    chr6:84558409-84558334 BLAT!
ACAATAATCCAGGTCTGGGAACTCCCAGGAAACAAGTTTAATTAAGGTGACTAGTTCTGG
CATGGAGAAGGAGGGACCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>32073 113 315     4p15.1    chr4:28628683-28628571 BLAT!
AAAAAATAATATATGCAATAAAATATTCAAATCTTACTTTATCATAATCTGAACTATATC
AGATTATATTTGAAGCTTCAAGCTTCTAGAAATGGTTTACCTGGTAGTAATTT


invisible?    
Gene introns: 0  

>12113 169 314     14q32.2    chr14:97042171-97042339 BLAT!
TTCATTATGTTGTATATAAAATGTGAATGTGGTAAATGTCTAAAATGTGAATTGTGGGTG
AATATGTCACTGGGCAAATTGATTATTAGGTGAATTGGTTTTAGGCAAATTTGATGTTAT
CTTGAATTTGTTAATGTTGATTTTTTCTAATTATAGTCATAATTCATAT


invisible?    
Gene introns: 0  

>29623 135 314     8q21.12    chr8:79969870-79969736 BLAT!
TATAAAATATTTCAGTAAAGTAGCTATATTAAAATTCCAGAAAACATTCATGACATCCTA
ACATAAGGGAAACAAATGGTAAACAAATAATGCTGAAAGAAATTGTGGTAGATGACGGTG
CACTGAGTGGTAGCC


invisible?    
Gene introns: 0  

>30413 124 314     9q21.33    chr9:87723068-87723191 BLAT!
AGATCAGCTGCTCACACAACAGTCATGTTGCCATGACCTCCTTCTCCCAGGTGGGAGAAG
GGAAGATTATCTCCATGGTCAGTCCTGCAGATACCACCTGGTAGGGGAATCGGAGCATGC
CACC


invisible?    
Gene introns: 0  

>11555 119 313     4q13.2    chr4:68096457-68096557 BLAT!
AGGTTTTCTGACTCCCTATCACACTAAAATCACCCACCCCAGGATCAGCAGCAGGCAAGC
GATGGTCATTCTTAGTAATATCCTTGGATCCACTCCCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>30276 102 313     16p11.2    chr16:33866579-33866644 BLAT!
GGAGTGGAGTGGAATGGAATGAAGTGGAGTGGAATGGAGCGGAGTGGAGTGGAGTGGAAT
GGAATGGAGTGGACTGGAATGAAGTGGATTGCAGCAGAGTGG


invisible?    
Gene introns: 0  

>198 111 312     Xq22.1    chrX:100903533-100903643 BLAT!
CATGGCACATGTATACATATGTAACTAACCTGCACATTGTGCACATGTATCCTAAAACTT
AAAGTATAATAAAAAAAATTTCAAATACATGGTTTTTAAAACATATTACCT


invisible?    
Gene introns: 0  

>7638 128 311     3q13.31    chr3:117198401-117198274 BLAT!
GAGCTTCGGATCAGAATGACATCCCTGGCGACAGACATGTCTTATAGGCTCTAGATTATG
TCAAGATATCTGTAGCCCACCCAACAGTTGCTGCAGGAATTACTAGCTACCTCCCTCCAC
AAGAACAA


invisible?    
Gene introns: 0  

>9795 127 311     Xq21.31    chrX:89294476-89294602 BLAT!
TCCATCTCTTGATAAACATCAGGAGACAAATGAAGAATTCCTTTTGGAGTATTATTTGTT
GGTTCGGGAAACCCAGGCTTTGGACCACTCCATCCTTTGTTTTCCCCTGTCTTCTCAAGT
TGATCCT


invisible?    
Gene introns: 0  

>16190 133 311     3p21.2    chr3:52250623-52250491 BLAT!
AGGATGGGAGACGGGTCTGGAGAACTGGATGGGACCTTGATCCCAACTTTGTCAGCCTGT
GTGAGGAGCTTAGGGTTTTGTTTTGTTTTGAGATGGAATCTCACTCTGTCACCCAGGCTG
GAGTGCAGTGGCA


invisible?    
Gene introns: 0  

>20114 125 311     20q12    chr20:38702919-38702795 BLAT!
TGTGCTACTTTGGATAAGCCCTTTATATCTAGGATAACCATATAATTTATCTTTCAAACC
AGGGCATTCCTGAGAATAGTGCCTGGCATGTAATAAGCACTAGGGATGAGACTACACTCC
TGAGA


invisible?    
Gene introns: 0  

>26135 152 311     21q22.3    chr21:46265333-46265484 BLAT!
ACCTGTTCCCTTAACCGTAAACATCCAGAGGCCAGGAATGCCAGACTTTCTGAGAATGCA
GCCCACCAAGTCCCAGACCCTACTCAAGATGGAGTCACTCTGGTTCGAACGCTTCTGACA
GATGTGTCCAATGCATGGATGAAATTCTGCCA


invisible?    
Gene introns: 0  

>26605 140 311     8q24.13    chr8:122818478-122818339 BLAT!
CCCATCCACCATGGGAAGCTTCTCTAACATTGAATCACAGAGACAGTTTCAGATTAGCCC
TATGACCCACGAACAAATGGTCCTTTTACAGACATTCTGAAGCCATTTGTATATACAGTC
ATTCATTTATAAAACCAAAA


invisible?    
Gene introns: 0  

>27622 158 311     14q21.2    chr14:45151481-45151638 BLAT!
CTGATTCTTCCAATTAATAGATGTGAAGAGACTAAATCAGCATATTTATTGCAGAATGAA
ACTTGATATGTCTCCAACACATTTTATAAACAACAGAGTTTGATTTTTATCCATCTAAGT
AATAATTTTTGGACAATTTTTAGTATGTATACTATTCC


invisible?    
Gene introns: 0  

>6018 123 310     17q21.33    chr17:48899397-48899519 BLAT!
AGCTAACTATGATTTATCCTTCAGGTCTCAGTATTGATGTCACTTCTTCTAGAAGCCCTT
ACCTGACCTTACTTTTAATGGGAAATAGGGCTTTTACCCTCTAATGCTGTTCCCCTAGAA
TCT


invisible?    
Gene introns: 0  

>7382 123 310     2q14.2    chr2:119242129-119242007 BLAT!
AAAAAGCAGGAAGGGAAGGCCACCTCTTCCTTCTCTAACCCCACCCATGCCCCAGTGCAG
GTCCTCCCTGGGATTGGCAAAACTCTTGAGTTAAAAAACAAAGCAAAGCAGAACTCCCAA
TAT


invisible?    
Gene introns: 0  

>8341 152 310     2q14.3    chr2:124138468-124138619 BLAT!
GCTGGCTTTTTTCTACTTCCCTGACAACCTACATGGCACAACAGAGGCAGCCATAATTCT
CCTGGGAACATAACTCTAGTGACCTGGAAACCATACCCCTATCTCTCACAGCAGCCGCAG
CAAGCCCTGCCCAAGGAGAGTCTGAGCTCAGA


invisible?    
Gene introns: 0  

>8652 144 310     6q22.31    chr6:122606911-122607054 BLAT!
AGAGCACAGAACAAATACAAAAATAAGCCTCATCACATAGGACTGGCAAACTCAAGGAAG
ATCTTGGACTTAATTATTTTGAAAACCTAAAATGAAGGGTTTGTTTCAGAAAAGAAAGAG
AAGGCAATGAGTTAGATACAGGCA


invisible?    
Gene introns: 0  

>11105 114 310     Xp22.31    chrX:6443976-6443863 BLAT!
TTGCAGAGAACAAGATCTTGCTGTATTACCAAGCTCATCTTAAACTGAACTCCGGGCCTC
AAGAGATCCTCCCAACTTGGCCTCCCAAAGTGCTGGAATTACAGGTGTGAGCCA


invisible?    
Gene introns: 0  

>13426 164 310     6q16.1    chr6:93324897-93325060 BLAT!
GATTGGTATCAATTCTGCTTTGAATGTGTGATAGAATTCAGCTGTGAATTCGTCTGGTCC
TGGATTTTCTTTGGTTGGCAATATTTTTTATACAATTTTAATCTTGTTGCTTGTTATCAG
TCTGTTCAGAGTTTCTATATCTTCCTGGTTTAATCTAGGAGGGT


invisible?    
Gene introns: 0  

>17145 173 310     6p12.3    chr6:48161523-48161695 BLAT!
GTTGCTAAAAATCACATTATACAAACTAACACAAGAAAAACCATAGGGCTTATGAGAAAA
GGGGGCTAGGAGCACAACACTGAAAATTTTGTTAGTAACACATTAGACAAAAAGATAAGA
ACCTAACTAAAATAGTAGCACAGTTTTGCACATATTAAATGGTTAAGAAATAA


invisible?    
Gene introns: 0  

>9489 168 309     10q24.2    chr10:100370530-100370363 BLAT!
CTTGACATTCTAGGGACATGCACATAAATTCATCTATGGAACTAATAATCTGATATGTGT
TTGTGGGACTACAATTTAGTCCTCTATTTGGAATAAAATAAAAAGCTAGATCACATTGGA
TTGCCTTTTCCACAGTGGGCACAGTGGTATGGAAATTTACTGCCAGCA


invisible?    
Gene introns: HPSE2 (100216833 - 100995632)  

>16051 161 309     3p12.1    chr3:84095921-84096081 BLAT!
CAGACTGAAAAAAGATAATTTTTCTTTATGATGCATCTTGGTCCCAGCAGGATGGTGTGG
CAAGCTGAGTCACTAAGGCTGCTCAGGGAAAGGGAACCCAGAATCTTGGCATGCCGGCAA
AAGAGTAAGAATTTCTTACAAGTCAGGTTTCTGGCTTTTCT


invisible?    
Gene introns: 0  

>22562 112 309     11q22.3    chr11:106027384-106027495 BLAT!
GAGAAGAAAAATGCTTATTTCAGCTATGTTCCCTAGATAGCAAAGCACTGAGCATTTTTG
GAGATTGCAGGTGAATTGATGATTAAGCAAATTAATCATGAAAAAATGAAGT


invisible?    
Gene introns: 0  

>24130 113 309     14q31.3    chr14:87498265-87498377 BLAT!
AAGAAAAGCGCTTCCAAATTTTGAGTTTTGGCAATAATTTTATTGGACATTTTGAAGGTA
GAAGGGATTTCTTATTAGGTAATAAAGAAGCAAGTAAAACTCACTTCAAAAAG


invisible?    
Gene introns: 0  

>26123 129 309     2q23.3    chr2:151509610-151509738 BLAT!
AGAATTTAAACTCTGTTTCTGAATCTGGGGACCCAAGGCTAGGCTTCATCATTCCTCTGA
AATAGTAGGTAATATTGTATGTATCTCCACACTTTTCCAAGGAAGAGGATCATTGCATTT
GTCAGATTC


invisible?    
Gene introns: 0  

>1348 106 308     4q35.1    chr4:184447608-184447512 BLAT!
ATGGGCACGGTGGCTGATGCCTGTAATCCCAGCACTTTGGGAGGCCTAGCTGGGCGGATC
ACCTGAGCTCGGGAGTCTGAGACGAGCCTGACCAACAGGCTGTATT


invisible?    
Gene introns: 0  

>16767 143 308     13q13.3    chr13:37864432-37864574 BLAT!
AAGAGTTTAGTAATTTTTGACCTCATCCCACTAATTATACGGGCTGAAACATAGAACTGT
AGTTCTGTTTGGAACAGACATGATAGCATCCCTACCATTTATCTCTTCTCAGAGTATAAA
ACTCCAGTCACAAATTCCCTTTT


invisible?    
Gene introns: 0  

Shown 2191-2220 from 3142 sequences on 74 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs