Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 1831-1860 from 3142 sequences on 62 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>1059 120 402     1p34.3    chr1:35035915-35036034 BLAT!
ATTTTATTTCTCCTTCACTTATGAAGCTTAGTTTGGCTGGATATGAAATTCTGGGTTGAA
AATTCTTTTCTTTAAGAATGTTGAATATTGGCCCCCACTCTCTTCTGGCTTGTAGGGTTT


invisible?    
Gene introns: 0  

>3765 132 402     7q21.11    chr7:84421913-84421782 BLAT!
TGTCTAAGAAACAGCTACTAATTTTTAAAAATTATTCTCTAACATTATCTTTTATCGAAA
AGTTTTACTACACTATAGGTAAAATTTACCACTACATTTCTTAGGCCTTCAATGTCTTTC
TTGCGTATTTCT


invisible?    
Gene introns: 0  

>17551 182 402     9p24.2    chr9:2490460-2490279 BLAT!
GACCCCTTTTCTAATAAATACCCTCGCCTTCTCCACTTCCCCTGAGCCTAGATCACTGCT
TCTTCTCAGACTCTAGTCCCTCCCTTCAATTTGTCCTGCTTGTATTTCATCTTCTTTAAT
CACTGGTTTCATCACATCACTCCCATGCTCAGAAACCCTTAAGGGATTTTTATTTCCCAC
CA


invisible?    
Gene introns: 0  

>11799 151 401     4q32.1    chr4:161610781-161610631 BLAT!
TCCCAGCACTTTGGGAGGCCGAGGCAGGCAGATCACGAGATCAAGAGATTGAGATCATCC
TGGCCAAGACGGTGAAACCCCGTCTCTACTAAAAATATACAAAAATCAGCCAGGCATGGT
GGTGCGCACCTGTAGTCCCAGCTACTCAGGA


invisible?    
Gene introns: 0  

>22165 133 401     Xq22.1    chrX:100057669-100057544 BLAT!
GGGAAGCTCTACAGGTGGTATTTCCATCTGCTCTACCTGCTGAGGAGGCATCACAGGCTC
TGGGTCAATTTGTCCAGCTTTTCGCTTAACTCCCTGAGGTGGTGGTGGAGGCATAGCTGA
CTCATCTATGTTT


invisible?    
Gene introns: 0  

>14754 145 400     Xq11.2    chrX:63498517-63498573 BLAT!
CTGCAGAAAACACAAAAATTAGGTGGGCATGATTGGTGCATGCCTGTTGTCCCAGCTAAT
TTTTTGTATTTTAGTAGAGACGGGGTTACACCATGTTCATCAGGCTGGTCTCCCATCGCT
AAAAAAACATTTAGAAAATAGCACA


invisible?    
Gene introns: MTMR8 (63487960 - 63615333)  

>20084 163 400     4q26    chr4:116443380-116443218 BLAT!
GAGGGAAATTCATAGCACTCGATGCCCACATCAGAAAGATGGGAAAGATCTAAAATCCAC
ACCCTAACATCACAATTAAAAGAACTGATAGCAAGAGCAAACAAATTCAAATGCTAACAG
AAGACAAAATATAACTAAGATCAGAGCAGAACTGAAGGAGATA


invisible?    
Gene introns: 0  

>15235 130 399     8q23.3    chr8:113660028-113660157 BLAT!
ATTTTACATTGCCAATGTTTTAAGTTGCATTTGTTTTATATTGTCAGCTGCAAGTGGTGA
TCATAATAGCACTTATCTATAGAGTTACTTGGAAGAGAAAATGACTTAAAATACATAAGG
CACCTGTAGC


invisible?    
Gene introns: CSMD3 (113235158 - 114449242)  

>27121 140 399     12q12    chr12:41968470-41968331 BLAT!
GTCTTCTAAATAGTATACACATATAACTACTTTATAACTGTCAACCACTGTGGACAAGGA
AAATAAAACACTCCTTGATAATTTTTCTGAAGGATAATCAATAATTTATTTCTCTTTAAT
TGTCACAATTACCATAATTA


invisible?    
Gene introns: PDZRN4 (41582249 - 41968392)  

>27373 121 399     1p34.3    chr1:39149509-39149389 BLAT!
AGGGGCCAAGATCCTCTTAAAGAATAAGAAGAAGCTGGGGGGATTTTCATCCACCAGATA
ACAAGGCTTATCATAAAGCTGTAGTAATTAGGGTGGTGATCAATGAATAGGACAGAAGAA
A


invisible?    
Gene introns: 0  

>31991 213 399     9q21.33    chr9:88549807-88549983 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGCAGAACAGTTTTATAGAAAGCTTTTAAACAAG
CATGGAATTAAAACCGTTTCTCAGATTATCTCCCTCCAAACTCTAAAGAAGGAATATAAA
TCCTATGAAGCCAAGCTCCGCCTTCTGAGCAGTTTTGACTTCTTCCTTACTGATGCCAGA
ATTAGGCGGCTCTTACCCTCACTCATTGGGAGA


invisible?    
Gene introns: 0  

>10810 182 398     1q32.3    chr1:214317101-214317282 BLAT!
TGAGGCTGAACCTTGCTCATCAACTATTCGTTTCTCTTTCAAGCATTTCCTGACACTTGC
TAAGCCTGAACCTCTGTGGCAGGTGCTAAGAAAGAGAAGCAAGTGAATATGGTGGAAGGC
AAAGGAAGGGGCCCATGGGGGCAAGTGATGGGGACTGCTAAGGTATTATCAATGTTTTAT
TT


invisible?    
Gene introns: 0  

>24549 126 398     7q31.2    chr7:114678306-114678181 BLAT!
AGACCACCGTGGAATCCAGTTTGGCCAGAGTAAGTGCAGCTTAGCAATGTGGGATCTTAC
CACTGGGAGCAATGTCAGGCAATGGAGTAGGAGTTTCCGGATTAATGTCCCTACTTCCTA
TCCTTT


invisible?    
Gene introns: 0  

>29252 165 398     12q24.21    chr12:115026488-115026355 BLAT!
GTTCTAGCACCTTTTGCCAGAAGCAACTGGACGATATCTGCATAACCCTTCCAGGCAGCA
GCATGCAAAGCTGTATCTCCCAACTTGTTCTGCTGGTTCAGTTCAATATTTGGTTGAGTA
AATAGCATTTCCACTATATCTTTGTGGCCCCCGTGGCAAGCCCAG


invisible?    
Gene introns: 0  

>29386 119 398     5q31.3    chr5:143739359-143739477 BLAT!
AATCAGGATTCTTTATCTAGGGGTCTTATTCTAGAGTCTAGAAGTCAATGGATGTGCCCC
TCCGAAAACTTGTGCAAAGCCTTGTGTAAATGTGCATTTTCTGGTAGAGAAGATCTGTG


invisible?    
Gene introns: KCTD16 (143550436 - 143856944)  

>29693 159 398     16p11.2    chr16:33887636-33887717 BLAT!
CATTCCATTCCATTCCACTCCACTCCACTCCATTCCATTTCACTCCACTCCACTCCATTC
CATTCCTTTCCATTGCATTCCATTAAATTCCACACCACTCCGATCCACTCCACTCAACTC
CACTCCAATCCACTCCACTCCAATCTGTTCCTTTCCGTT


invisible?    
Gene introns: 0  

>13760 159 397     10q25.1    chr10:110201551-110201709 BLAT!
AAACTACCATCAGAGTGAACAGGCAACCTACAGAATGGGAGAAAATTTTTGCAATCTACT
CATCTGACAAAGGGCTAATATCCGGAATCTACAATGAACTCAAACAAATTTACAAGAAAA
GAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGA


invisible?    
Gene introns: 0  

>19056 157 397     9q21.11    chr9:71722885-71723041 BLAT!
GAAAGCATATACATAGGGCCAAATCTTGTTGGTTTCTGTTCCGGAGAATGTTTCCAGCAC
CCCTTTTTTCTGGTAATATTCCAGGACTGGCTTTGTTTGGTCTTCATAAGCCTTTAGTCT
CTTGATAACCGTCTCTGGTTTATCATCCTCACGCTGA


invisible?    
Gene introns: 0  

>26132 122 397     15q25.3    chr15:87949146-87949267 BLAT!
GGCCCTGTGTAGCAAGCCATGCCCTCCTGTGTCCAAGACATGTGAGAATATTAATAAGCT
TTGTTTTCCTGAGCATCTCCTGCATCTCCGCTTGTGGCCACACCTGACTGCCCATCACAT
AA


invisible?    
Gene introns: 0  

>19979 162 396     10q25.1    chr10:110186495-110186656 BLAT!
GAAATCTAGATCTTTCCTATAACTTCATTGCTGGGACCCTTTAGTCCTCTGTCCCTACTC
CCCTGCCTGCATTGATCAAACACAAAGGGGACCTGGAGCCTATAGAAGATGGAGATCCCT
GTGTCCTGTGCAGACAAGGTCAGACTTCCCTGAGGCAGAAGA


invisible?    
Gene introns: 0  

>23925 150 396     11p12    chr11:40533946-40533808 BLAT!
TTGTTTGTTTTTGTTTTTGTTTTGAGATGGAGTCTCACTGTGTTGACCAGGCTGGAGTGC
AATGGTATGATCTCGGCTCACTGCAACCTCTGCCTCCAGGGTTGAAGCAATTCTCTCACC
TCAGCTCCCGAGTAGCTGGGATTACAGGCA


invisible?    
Gene introns: 0  

>6384 154 395     2p23.1    chr2:30130601-30130448 BLAT!
TATTTACATGCACGTGGTAATTTAATCCTTGAAAAAAAGAGATGAGTTTTCCAGAGGACG
TAGAGAGAGGAAAGAAGGAAGGTCACAGCTTAGATTTAGGAAAGTTCATAATTAGACAGT
AGAATGGAGTCAATGACATCACCAGAAAGAATTT


invisible?    
Gene introns: ALK (29415639 - 30144432)  

>8038 142 395     7p14.3    chr7:30220408-30220267 BLAT!
AACTGCACACATCAGAATGGAAATACATTAGGTCAACAGATAGAGTGAAAAATACAAGAT
AATAAGATCCAGAAGAGTCAGAACCAAAAGAGCTGGGACCTGACAGAACCATGTGGCCAA
AGCTGAATGTCAAGATTTCACG


invisible?    
Gene introns: 0  

>9372 135 395     20p11.21    chr20:24913099-24913233 BLAT!
TGTAGCTCATTCCCTTAATGTTACTTCTTGTTATATATGCGGGGGAACCACTATCAGAGA
CCGATGGCCTTGGGAAGCCTGAGAGTTGGTGCCCACTGATCCAGCTCCTGATATAATGGG
GGCTTGTCCAGGATC


invisible?    
Gene introns: 0  

>10936 111 395     18q21.33    chr18:59166777-59166667 BLAT!
TGTGTGTGTGTGTGTATATATATAGGAGGTGCTATTTGTGAAAATCAGCGAGTCACCACC
TTACCCACAGGGGACATTTCTGGCACAGTGGCCACATAAGGTCCGTCCAGG


invisible?    
Gene introns: CDH20 (59157774 - 59222365)  

>13106 174 395     15q21.1    chr15:46367430-46367257 BLAT!
GACAGAAAAACTGTCATTCTCATCGCGTTGATATCTGCTATACTCTGCTTCCCCACTTCT
CATTCCACTCTTTGTCCCTTCCTCAGATCCCCTTCTAGAACCCTCTCCCTGCATAAAGAA
ACTCAGTAAACCTGAAAAATTTGCAGGGAGTAAATATAACTCTCAAAAGTAGCC


invisible?    
Gene introns: 0  

>22199 150 395     3q25.2    chr3:152937704-152937558 BLAT!
AAAATTAGCTGGGTGTGTTGGCACATGCCTGTAGTCCCAGCTACTTGAGAGGCTGAGGCA
GGAGAATCACTTCAACCCAGGAGGTGGAGGTTACAGTGAGCAGAGATCGTGCCACTGCAC
TCCAGCCTGGGTGACAAGAGAGACTTGTCT


invisible?    
Gene introns: 0  

>24246 156 395     Xq22.3    chrX:106830013-106830167 BLAT!
TTCTAATATGATTTCACTGTGGTCTGTGAGACTATCTGTTATGGTTTCAGTTCCTTTGCA
TTTGTTAAGGAGGGGGTTAATTCCAATTATGTGGTTAATTTTAGAATAAGTGACATGTGG
CACTGAGAAGAATATATATGCTGTTGATTTAGGGTA


invisible?    
Gene introns: 0  

>24848 172 395     12q24.22    chr12:118074629-118074458 BLAT!
AACGTTAATGCAGTCAAATGTATCATTTCTTTCCTTTATGGTGTTGACTTTTAAAAAATG
TTATTTAACAAATTCTTCTTCCCTGAGGTCATAAACGTATTGTTCTATATATTCTTCTAA
AATCTGTGAAGTTTTGCCTTTCACATTTAAGCTCCTAATCAACCTGGAATTG


invisible?    
Gene introns: KSR2 (117890816 - 118406028)  

>33242 100 395     6p12.3    chr6:47111892-47111793 BLAT!
GGAAAAAAAAGACAAAAAAATACCTTACAAAGTAGAGAGAAAAGAAAATTTGAGGAGGGT
CAATTTATTCCAGAAGTAGAAAACAAAATACCAAGGGGAG


invisible?    
Gene introns: 0  

Shown 1831-1860 from 3142 sequences on 62 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs